Table 1

Primers used to amplify specific regions of the LSU rRNA gene from oyster (Crassostrea virginica) genomic DNA and cDNA template (* primers are from [42]).

Region

Primer

5' to 3' oligonucleotide sequence

Product length

Annealing temperature


5' portion

mt168-F *

GGATTCTGTTTGTCCGCAGCATT

233 bp

50°C


mt169-R *

CACCATATAGCTATCTTTAGTTGA


3' portion

mt89-F *

CAGTACCTGCCCAGTGCGACAA

494 bp

58°C


16SBR *

CCGGTCTGAACTCAGATCACGT


full LSU rRNA

dCv-Ai-LSU-f

CTTTWGCAKMATGGCYTTWTGAG

~773 bp in Cv

55°C


dCv-Ai-LSU-r

CACGGGGTCTTCTTGTCTWWCTTT

748 bp in Ai


The final set of primers was used to amplify scallop (Argopecten irradians) genomic DNA and cDNA, and would amplify in C. virginica cDNA if the fragments were spliced post-transcriptionally.

Milbury et al. BMC Genomics 2010 11:485   doi:10.1186/1471-2164-11-485

Open Data