Table 4

Validation of microarray data using real time PCR.

Relative expression level V1/V14


AMC

CNS


Gene Primers

Microarray

Q-PCR

Microarray

Q-PCR


caps

F 5'GCAGCCTGGATGAAGGTTTA 3'

R 5'ATGGCGCAGCCATAGTAGTC 3'

1.38

0.63

3.8

2.38


Cdk4

F 5' TACAACAGCACCGTGGACAT 3'

R 5' GGTCCAGCTGATTCTTTTCG 3'

0.95

1.3

4.99

2.5


hb

F 5' CCTTCCAGTGCGACAAATG 3'

R 5' ATCCGCACAACGGTACTGA 3'

6.71

0.85

6.38

1.6


Iap2

F 5'AAGGACTGGCCGAATCCCAACATC 3'

R 5' CGTTGCACCAAACACACTTC 3'

3.69

2.16

6.48

1.9


nak

F 5'AGGAAGCATCACAGCAAAAT 3'

R 5'GCACCAGGAGCAGCTGTAAC 3'

1.75

1.36

0.97

1.95


nej

F 5'AATGGATCCAACGGATATCTCT 3'

R 5'CTGATCCGACCAGCCACTAT 3'

3.26

1.63

3.79

3.75


Notch

F 5'AACACCGTTCGCGGAACTGATACCG 3'

R 5'GGTTTTGCCATTGAGTTGTG 3'

2.9

1.76

8.96

2.52


The relative expression level (V1/V14) of selected genes was measured using the Q- PCR or microarray analysis data; Our results were consistent with the microarray data except for the hb (hunchback) gene found to be overexpressed in the CNS but not in the AMC. The values in gray correspond to the genes found differentially expressed between V1 and V14 in the CNS but not in the AMC using microarray analysis. Accordingly, no significant variation was found for these genes in the AMC, using Q-PCR.

Guenin et al. BMC Genomics 2010 11:47   doi:10.1186/1471-2164-11-47

Open Data