Table 1

Sampling localities, tissue sources, and PCR primer sequences for the six vermetid species examined in this study

Species

FMNH voucher #

GenBank accession #

Locality

Tissue

Primer Set A (5'-3')

rrnL-F/cox1-R

Fragment Size (bp)

Primer Set B (5'-3')

rrnL-R/cox1-F

Fragment Size (bp)


Dendropoma maximum (Sowerby1825)

FMNH 318221

HM174253

Gulf of Aqaba, Jordan

Foot tissue; buccal mass

CGAATTGAAAGGGGGGCTTGTGACCTCGATGTTG

TTTCGATCCGTTAAAAGCATAGTGATAGCTCC

6877

ACGCTACCTTCGCACGGTCAAAGTACCGCGGC

TTGTTATGCCAATAATGATTGGTGGTTTCGG

8809

Dendropoma gregarium Hadfield & Kay 1972

FMNH 318222

HM174252

HI, USA

Foot tissue; buccal mass

CAAATCGAAAAAAGGGTTTGCGACCTCGATGTTG

TTACGGTCAGTTAAGAGTATGGTAATAGCACC

6490

ATGCTACCTTTGCACGGTCAGGGTACCGCGGC

TGGTAATACCCATGATAATTGGAGGTTTTGG

9254

Eualetes tulipa (Chenu1843)

FMNH 318223

HM174254

Peanut Island, Palm Beach Co., FL, USA

Buccal mass

CATATCGAAAGAATAGTTTGCGACCTCGATGTTG

TTTCGGTCCGTCAACAATATTGTAATTGCCCC

6880

TTCAACGAGAGCGACGGGCGATATGTACAC (rrnS-R)

TGGTAATGCCTATAATGATTGGGGGGTTCGG

7472

Thylacodes squamigerus1 (Carpenter, 1857)

FMNH 318997

HM174255

Corona del Mar, CA, USA

Foot tissue

CCCATCGAAAGAAGAGTTTGTGACCTCGATGTTG

TTTCGGTCCGTCAACAGCATAGTAATAGCTCC

6648

ATGCTACCTTTGCACGGTCAGAGTACCGCGGC

TGGTTATACCAATAATAATTGGTGGCTTCGG

9034

Thylaeodus

sp.

FMNH 318224

HM174256

Kewalo Marine Laboratory, HI, USA

Head, foot & mantle margin

CATATTGAAAAAAAAGTTTGTGACCTCGATGTTG

TTTCGATCAGTCAATAACATAGTAATTGCGCC

4703

ATGCTACCTTTGCACGGTCAGAGTACCGCGGC

TAGTAATACCTATAATAATTGGTGGATTTGG

N/A

Vermetus erectus Dall, 1888

FMNH 318225

HM174257

Pourtales Terrace, Florida Keys; FL, USA

Foot tissue; buccal mass

CTAATCGAAGAAAAGGCTTGTGACCTCGATGTTG

TTTCGGTCAGTCAGTAGTATAGTAATAGCACC

3107

ATGCTACCTTAGCACGGTTAAAATACCGCGGC

TTGTCATGCCTATAATAATTGGCGGATTTGG

N/A


1Thylacodes has been demonstrated to have priority over Serpulorbis; hence Serpulorbis squamigerus is now correctly referred to as Thylacodes squamigerus (see [62]).

Rawlings et al. BMC Genomics 2010 11:440   doi:10.1186/1471-2164-11-440

Open Data