Open Access Research article

Prednisolone-induced differential gene expression in mouse liver carrying wild type or a dimerization-defective glucocorticoid receptor

Raoul Frijters1, Wilco Fleuren1, Erik JM Toonen3, Jan P Tuckermann5, Holger M Reichardt6, Hans van der Maaden4, Andrea van Elsas3, Marie-Jose van Lierop3, Wim Dokter3, Jacob de Vlieg1,2 and Wynand Alkema2*

Author Affiliations

1 Computational Drug Discovery (CDD), Nijmegen Centre for Molecular Life Sciences (NCMLS), Radboud University Nijmegen Medical Centre, Geert Grooteplein Zuid 26-28, 6525 GA Nijmegen, the Netherlands

2 Department of Molecular Design & Informatics, Schering-Plough, Molenstraat 110, 5342 CC Oss, the Netherlands

3 Department of Immunotherapeutics, Schering-Plough, Molenstraat 110, 5342 CC Oss, the Netherlands

4 Molecular Pharmacology Department, Schering-Plough, Molenstraat 110, 5342 CC Oss, the Netherlands

5 Tuckermann Lab, Leibniz Institute for Age Research - Fritz Lipmann Institute, Beutenbergstraße 11, 07745 Jena, Germany

6 Department of Cellular and Molecular Immunology, University of Göttingen Medical School, Humboldtallee 34, 37073 Göttingen, Germany

For all author emails, please log on.

BMC Genomics 2010, 11:359 doi:10.1186/1471-2164-11-359


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2164/11/359


Received:5 February 2010
Accepted:5 June 2010
Published:5 June 2010

© 2010 Frijters et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Glucocorticoids (GCs) control expression of a large number of genes via binding to the GC receptor (GR). Transcription may be regulated either by binding of the GR dimer to DNA regulatory elements or by protein-protein interactions of GR monomers with other transcription factors. Although the type of regulation for a number of individual target genes is known, the relative contribution of both mechanisms to the regulation of the entire transcriptional program remains elusive. To study the importance of GR dimerization in the regulation of gene expression, we performed gene expression profiling of livers of prednisolone-treated wild type (WT) and mice that have lost the ability to form GR dimers (GRdim).

Results

The GR target genes identified in WT mice were predominantly related to glucose metabolism, the cell cycle, apoptosis and inflammation. In GRdim mice, the level of prednisolone-induced gene expression was significantly reduced compared to WT, but not completely absent. Interestingly, for a set of genes, involved in cell cycle and apoptosis processes and strongly related to Foxo3a and p53, induction by prednisolone was completely abolished in GRdim mice. In contrast, glucose metabolism-related genes were still modestly upregulated in GRdim mice upon prednisolone treatment. Finally, we identified several novel GC-inducible genes from which Fam107a, a putative histone acetyltransferase complex interacting protein, was most strongly dependent on GR dimerization.

Conclusions

This study on prednisolone-induced effects in livers of WT and GRdim mice identified a number of interesting candidate genes and pathways regulated by GR dimers and sheds new light onto the complex transcriptional regulation of liver function by GCs.

Background

Naturally occurring glucocorticoids (GCs), such as cortisol, play an important role in the regulation of cardiovascular, metabolic and immunological processes. GCs are potent suppressors of inflammatory indices and are widely used to treat chronic inflammatory diseases such as rheumatoid arthritis and asthma [1-3]. However, chronic use of GCs induces side effects, such as diabetes mellitus, fat redistribution, osteoporosis, muscle atrophy, glaucoma and skin thinning [4].

One of the aspects influencing the balance between the desired anti-inflammatory effects and the side effects of GCs is the activation and repression of gene expression. After binding of GCs to the cytosolic GC receptor (GR), the receptor-ligand complex translocates to the nucleus where it alters gene expression. Ligand-bound GR can influence the expression of target genes, either by binding as a dimer to palindromic GC response elements (GRE) or tethering to other DNA-bound transcription factors [5,6].

It is generally assumed that the anti-inflammatory actions of GCs are mainly driven by transrepression, in which ligand-bound GR binds to the pro-inflammatory transcription factors NF-κB (Nuclear factor kappa-light-chain-enhancer of activated B cells), AP-1 (Activator protein 1), IRF-3 (Interferon regulatory factor 3) or other factors, forming an inactive transcription machinery complex, which prevents expression of pro-inflammatory genes [7-16]. However, recent studies demonstrated that under some inflammatory conditions DNA dimer-dependent gene expression could also contribute to the anti-inflammatory activities of the GR [17]. The occurrence of side effects has been linked mainly to transactivation of gene transcription. The well-documented example of GC-induced upregulation of Pck1 (Phosphoenolpyruvate carboxykinase 1; also known as Pepck) and G6pc (Glucose-6-phosphatase), two genes encoding key enzymes that control gluconeogenesis, is one example linking transactivation to metabolic side effects [18-20].

One of the mechanisms by which GR activates gene transcription is by binding as a homodimer to a GRE in the promoter region of a target gene. GR dimerization involves the D loop located in the DNA-binding domain of the GR, in which several amino acids interact to facilitate receptor dimer formation. It was shown that an A458T point mutation, introduced in the D loop of the GR (GRdim), impairs homodimerization and ablates DNA binding [21]. Mice carrying this GRdim mutation are almost as effective as wild type (WT) mice in repressing AP-1 and NF-κB-modulated gene transcription, whereas GR-mediated Tat (Tyrosine aminotransferase) mRNA induction is largely abolished [21,22].

The mechanism of dimer-dependent transactivation by the GR has been studied in detail for a limited number of GR target genes, including Fkbp5 (FK506 binding protein 5), Tat, Pck1 and Dusp1 (Dual specificity phosphatase 1) [23-26], and tethering-facilitated transrepression of Mmp1/Mmp13 (Matrix metallopeptidase 1/13), IL-8 (Interleukin 8) and others [27-29]. In order to perform a comprehensive study of the genes and cellular processes that are affected by GC-treatment and influenced by GR dimerization, we have performed genome wide gene expression profiling in liver of prednisolone-treated WT and GRdim mice.

We found that prednisolone predominantly influenced expression of genes involved in glucose metabolism, inflammation, the cell cycle and apoptosis. In general, activation of transcription, including transactivation of known GR marker genes such as Fkbp5 and Tat, was significantly reduced, but not totally absent in the GRdim mutant. However, a total absence of transcriptional transactivation upon GC-treatment was observed in GRdim mice for a subset of genes, all related to regulation of the cell cycle. In contrast, a small subset of genes was found exclusively regulated by GCs in GRdim mice. Furthermore, we identified Fam107a (Family with sequence similarity 107, member a; also known as Tu3a and Drr1) as a novel GC-inducible gene that completely relies on GR dimerization for transactivation.

Results

Clustering of individual samples

In order to chart the gene expression profile induced by prednisolone in WT and GRdim mice, 6 mice per group were treated with prednisolone or vehicle. A principal component analysis (PCA) on the normalized intensity data showed that the samples clustered into four distinct groups (Figure 1). The largest separation, represented by PC1, was observed between samples derived from male versus female mice. The genes with the highest gender specificity belong to the family of cytochrome P450 proteins, such as Cyp3a41, Cyp3a44 and Cyp4a12, which are known for their gender-specific expression [30,31]. In addition to the gender-based separation, a clear separation was observed between prednisolone-treated and vehicle-treated WT mice, whereas prednisolone-treated GRdim mice clustered closely together with vehicle-treated GRdim and WT mice (PC2). These results indicate that there is a significant prednisolone effect in WT mice, which is strongly reduced in prednisolone-treated GRdim mice. Genes with high loading scores on PC2 include Tat and Fkbp5, which are known GR-regulated genes in liver [32,33] (Figure 2).

thumbnailFigure 1. Principal component analysis on gene expression intensity data. A principal component analysis (PCA) was performed on normalized gene expression intensity data from 12 wild type (WT) mice (vehicle and prednisolone treatment) and 12 GRdim mice (vehicle and prednisolone treatment). Bullets: WT mice; Triangles: GRdim mice. White symbols: vehicle-treated mice; Black symbols: prednisolone-treated mice. The largest separation was seen between samples derived from male versus female mice (PC1).

thumbnailFigure 2. Intensity profiles of Tat and Fkbp5 in vehicle and prednisolone-treated wild type versus GRdim mice. The expression intensities of Tat (Tyrosine aminotransferase) and Fkbp5 (FK506 binding protein 5) in vehicle-treated (white bars) and prednisolone-treated (grey bars) wild type (WT) and GRdim mice are plotted. Symbols: Bullets: male mice; Triangles: female mice. Both Tat and Fkbp5 are known GR marker genes and show strong differential regulation in prednisolone-treated WT mice.

These results show that the transcriptional program that is induced by prednisolone in WT mice is strongly reduced in mice carrying the GRdim mutation. This supports the hypothesis that the loss of GR dimerization leads to a reduction in transcriptional transactivation by the GR and underscores the importance of GR dimerization in induction of gene expression. The effect of prednisolone on up and downregulated genes and pathways will be discussed in more detail below.

Prednisolone-induced changes in gene expression

To quantify the differences that were seen in the multivariate analysis, differentially expressed probe sets were identified for several treatment comparisons (e.g. prednisolone versus vehicle-treated WT mice and prednisolone vs. vehicle-treated GRdim mice). Probe sets were marked as differentially regulated when the p-value, corrected for multiple testing, was below the 0.01 cutoff value.

Prednisolone treatment resulted in a significant differential regulation of 518 probe sets in WT mice (347 upregulated and 171 downregulated; Additional file 1), whereas in prednisolone-treated GRdim mice only 34 probe sets were differentially regulated (29 upregulated and 5 downregulated; Additional file 2). Notably, no differentially regulated probe sets were found in the comparison between vehicle-treated GRdim and vehicle-treated WT mice, suggesting that the GRdim mutation itself does not cause differential gene regulation and that the effects between WT and GRdim mice only become apparent after treatment with prednisolone.

Additional file 1. Differentially regulated probe sets in liver of prednisolone-treated versus vehicle-treated wild type mice. Prednisolone treatment resulted in a significant differential regulation of 518 probe sets in wild type mice (347 upregulated and 171 downregulated; p-value < 0.01). The table shows the Affymetrix probe set identifiers of the differentially regulated probe sets, full gene names, gene symbols and the fold changes.

Format: XLS Size: 154KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Additional file 2. Differentially regulated probe sets in liver of prednisolone-treated versus vehicle-treated GRdimmice. Prednisolone treatment resulted in a significant differential regulation of 34 probe sets in GRdim mice (29 upregulated and 5 downregulated; p-value < 0.01). The table shows the Affymetrix probe set identifiers of the differentially regulated probe sets, full gene names, gene symbols and the fold changes.

Format: XLS Size: 23KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

The observation that only 34 probe sets are differentially regulated in GRdim mice upon prednisolone treatment, suggests that there is almost no regulation of gene expression by prednisolone in GRdim mice. However, a large number of the probe sets that are differentially regulated in WT mice showed the same direction of regulation by prednisolone in GRdim mice, but did not meet the cutoff value of 0.01 for the p-value. This indicates that induction of gene expression by prednisolone in GRdim mice is strongly reduced but not completely absent (see below).

Taken together these data are in line with the hypothesis that transactivation of gene expression through the GR is significantly reduced in mice carrying the GRdim mutation.

Biological processes targeted by prednisolone in WT mice

In order to identify cellular processes on which prednisolone has a prominent effect, a gene set enrichment analysis was conducted using the 518 probe sets that were differentially regulated in WT mice by prednisolone. For this analysis we used CoPub, a text mining tool that calculates which biological processes are significantly associated to a set of genes [34]. It appeared that the differentially regulated genes are predominantly involved in three major processes: (glucose) metabolism, cell cycle/apoptosis and immune/inflammatory response (Table 1).

Table 1. CoPub keyword enrichment analysis on prednisolone-regulated genes.

In order to gain insight into the relationships between genes and cellular processes a network representation was created, in which differentially regulated genes are plotted together with enriched keywords. In this representation, cellular processes that are affected by prednisolone can be appreciated as separate areas in the network, such as cell cycle and apoptosis, acute-phase response, and metabolism-related processes such as amino acid metabolism, gluconeogenesis and lipid metabolism. The most influential genes appear as highly connected hubs (Figure 3). Important factors that seem to connect the gluconeogenesis and the cell cycle and apoptosis subnetworks are the transcription factors Foxo1 and Foxo3a (Forkhead box O1 and Forkhead box O3a; see below).

thumbnailFigure 3. Literature-based network of glucocorticoid-induced effects. A network representation of the enrichment results was generated, in which differentially expressed genes together with enriched keywords are plotted. Genes are shown as circles (Red: upregulated; Green: downregulated), whereas enriched keywords are shown as squares. Connections between genes and keywords represent co-publications in Medline abstracts. To avoid an over-complex network, thresholds were set to simplify the interpretation of the results. Only keywords and genes that share at least 5 publications and have an R-scaled score of at least 45 are plotted in the network [34]. Several higher-order biological processes that are affected by prednisolone can be appreciated: cell cycle and apoptosis, acute-phase response, stress response, amino acid metabolism, gluconeogenesis and lipid metabolism.

Strong effects of prednisolone treatment on gluconeogenesis, the cell cycle and apoptosis are in line with the anticipated effect of the GR in the liver. The fact that many inflammation and acute phase response-related genes, such as IL6r (Interleukin 6 receptor) and Cxcl12 (Chemokine (C-X-C motif) ligand 12) were regulated (Figure 3) is interesting, given that we analyzed livers from healthy mice, not challenged with inflammatory stimuli. The direction and magnitude of prednisolone-induced differential regulation of genes involved in gluconeogenesis and the cell cycle was studied in more detail to get more insight into these prednisolone-affected processes.

Gluconeogenesis

Table 2 shows the prednisolone-regulated genes in WT mice identified by CoPub as being associated with gluconeogenesis. Among the upregulated genes are Pck1, encoding the rate limiting enzyme in gluconeogenesis [35], Ppargc1a (Peroxisome proliferative activated receptor, gamma, coactivator 1 alpha), a transcriptional coactivator that coordinates the expression of genes involved in gluconeogensis and ketogenesis [36], and Sds (Serine dehydratase) and Aass (Aminoadipate-semialdehyde synthase), two genes encoding enzymes involved in amino acid catabolism and amino acid utilization for gluconeogenesis [37,38].

Table 2. Prednisolone-regulated genes associated with 'gluconeogenesis' in literature.

The set of downregulated genes includes Irs1 (Insulin receptor substrate 1), a downstream mediator of the growth factor/insulin signaling pathway that negatively regulates gluconeogenesis [39] and Pklr (Pyruvate kinase), which encodes a glycolysis associated enzyme known to catalyze the production of pyruvate from phosphoenolpyruvate [40].

The direction of regulation and the function of these genes, suggests that in the liver of prednisolone-treated WT, glucose metabolism is balanced towards gluconeogenesis, which is in line with the reported gluconeogenic effect of glucocorticoids [41,42]. The reduced fold changes in GRdim mice compared to WT mice (Table 2) indicate that glucocorticoid-induced gluconeogenesis is reduced in GRdim mice.

Cell cycle

Table 3 shows the prednisolone-regulated genes in WT mice that CoPub identified as being associated with the cell cycle. Upregulated genes include Gadd45b, Gadd45g (Growth arrest and DNA-damage-inducible 45 beta and gamma), Cdkn1a (Cyclin-dependent kinase inhibitor 1a; also known as p21) and Plk3 (Polo-like kinase 3), which are stress sensors involved in cell cycle arrest, DNA repair and apoptosis [43-45]. Other upregulated genes are Bcl2l1 (also known as Bcl2-like1 and Bcl-xl), an anti-apoptotic protein that is enhanced by binding to the Gadd45 family [46,47], and Dusp1, a p53 target gene involved in cell cycle regulation [48].

Table 3. Prednisolone-regulated genes associated with 'cell cycle' in literature.

Amongst the downregulated genes are Ccnd2 (Cyclin D2) and Cks2 (Cdc28 protein kinase regulatory subunit 2), both involved in cell cycle progression [49,50]. Overall, the direction of the prednisolone-induced differential regulation of genes associated with the cell cycle suggests that prednisolone induces a cytostatic response in liver of WT mice.

Foxo transcription

From the literature-based network, the two transcription factors Foxo1 and Foxo3a appear to be intermediates between the gluconeogenesis and cell cycle and apoptosis subnetworks (Figure 3). Foxo transcription factors are key mediators of cell cycle progression, apoptosis, glucose metabolism, reactive oxygen species detoxification and DNA damage repair [51-54]. Their activity is tightly controlled by the insulin and growth factor-inducible Pi3k/Akt pathway. Akt-mediated phosphorylation of Foxo transcription factors promotes their translocation from the nucleus to the cytosol and thereby their inactivation through binding of 14-3-3 proteins [54-56].

Foxo transcription factors regulate gene expression of enzymes that are important regulators of gluconeogenesis, such as Pck1 and G6p [57,58]. In addition, they suppress genes that are involved in glycolysis, the pentose shunt and lipogenesis [59]. Analysis of Foxo1-overexpressing mice revealed an increased expression of Igfbp1 (Insulin-like growth factor binding protein 1), Pck1, Tat and Tdo (Tryptophan 2,3-dioxygenase) and downregulation of Srebf1 (Sterol regulatory element binding factor 1) and Adipor2 (Adiponectin receptor 2) in liver [59]. Interestingly, these genes are similarly regulated in prednisolone-treated WT mice (Figure 3 and Table 2).

Finally, Foxo transcription factors are regulators of cell cycle progression and were shown to induce Cdkn1a and Gadd45b [60] and to suppress Ccnd2 [54]. Also these genes show the same direction of regulation in prednisolone-treated WT mice (Figure 3 and Table 3). These observations suggest that GCs in WT mice induce Foxo transcription factors, which in turn may synergize with the GR to modulate the expression of their respective target genes.

Prednisolone-induced differential gene expression in WT versus GRdim mice

Table 2 and 3 list a number of genes that are significantly regulated by prednisolone in WT mice. In the GRdim mice these genes do not meet the significance cutoff for differential regulation (p < 0.01), but for most of them a small effect of prednisolone on the expression level can be observed in GRdim mice. To analyze these differences quantitatively, we plotted the log2 ratios of gene expression after prednisolone treatment in WT versus GRdim mice (Figure 4). This figure shows that on average, genes in WT mice are more strongly regulated than in GRdim mice after prednisolone treatment and confirms that induction of gene expression by prednisolone is not abrogated in GRdim mice but reduced to on average 33% of the level in WT mice, as indicated by the slope of the dotted line in Figure 4.

thumbnailFigure 4. Log2 ratio plot of prednisolone-induced differential gene expression in wild type versus GRdim mice. Genes on the solid black line show an equal induction of differential gene expression by prednisolone in wild type (WT) versus GRdim mice. The black-dotted line indicates the average slope of the data and shows that the level of gene regulation in prednisolone-treated GRdim mice is 33% of that observed in WT mice. A subset of genes that show obvious differences in the magnitude of regulation by prednisolone in WT versus GRdim mice is highlighted, as well as genes that show equal magnitude of regulation in WT versus GRdim mice.

Identification of genes that differentially respond to prednisolone in GRdim mice as compared to WT mice

In Figure 4, several genes are highlighted that show a different response upon prednisolone treatment in WT mice than in GRdim mice.

Unexpectedly, a small subset of these genes shows stronger upregulation by prednisolone in GRdim mice compared to WT mice. These genes include Car8 (Carbonic anhydrase 8), a protein associated with proliferation and invasiveness of colon cancer cells [61], Zdhhc23 (Zinc finger, DHHC-type containing 23), a Nitric oxide synthase-binding and activation protein [62], Flvcr2 (Feline leukemia virus subgroup C cellular receptor family, member 2), a calcium-chelate transporter [63], and Amy2 (Amylase 2), an amylase that catalyzes the endohydrolysis of 1,4-alpha-D-glucosidic linkages in oligosaccharides.

Genes that appear to strictly rely on GR dimerization include Dusp1, Gadd45b, Cdkn1a, Foxo3a, Plk3 and Fam107a (Figure 4 and 5). As discussed above, Foxo3a, Dusp1, Gadd45b, Cdkn1a and Plk3 all participate in cell cycle regulation, apoptosis and DNA damage repair [43-45,52]. The most striking difference in the level of regulation by prednisolone between WT and GRdim mice was observed for Fam107a (also known as Tu3a and Drr1) (Figure 4, 5 and 6). The expression profile suggests that transcription of Fam107a is under direct control of the GR and strictly depends on its dimerization. Fam107a encodes a ubiquitously expressed protein that was first described in the context of renal cell carcinoma, in which Fam107a expression is reduced or absent due to promotor hypermethylation [64-66]. Overexpression of Fam107a in Fam107a-negative cell lines leads to growth retardation and apoptosis, indicating that Fam107a might act as a tumor suppressor [65,67]

thumbnailFigure 5. Intensity profiles of Plk3, Dusp1, Gadd45b, Cdkn1a, Foxo3a and Fam107a in vehicle and prednisolone-treated wild type and GRdim mice. Several genes were identified that showed differences between prednisolone-treatment in wild type (WT) and GRdim mice. Amongst those genes are Plk3, Dusp1, Gadd45b, Cdkn1a, Foxo3a and Fam107a were differential regulated in prednisolone-treated WT mice, but not in GRdim mice. White bars represent vehicle-treated mice, whereas grey bars represent prednisolone-treated mice. Symbols; Triangles: female mice, Bullets: male mice.

thumbnailFigure 6. Validation of microarray-obtained gene expression by Q-PCR. The relative expression of Fam107a, Dusp1, Cdkn1a and Car8 in prednisolone-treated versus vehicle-treated wild type (WT) and GRdim mice was validated by Q-PCR. Differences in expression between two samples were calculated by the 2ΔΔCt method [103,104]. Mean differences in gene expression between WT and GRdim mice were analyzed using the Student's t-test. No expression was observed for Fam107a and Cdkn1a in vehicle and prednisolone-treated GRdim mice (Ct > 30). Asterisks denote p-values as follows: *p < 0.05, **p < 0.01 and ***p < 0.001.

We also identified a subset of genes that showed an equal induction of gene expression by prednisolone in WT and GRdim mice (located on the diagonal black line in Figure 4); Dst (Dystonin), a cytoskeletan-interacting protein postulated to cross-link cytoskeletal filaments and thereby maintain cellular integrity [68], Gtf2a2 (General transcription factor II A, 2), a subunit of the transcription initiation factor TFIIA [69], Agpat6 (1-acylglycerol-3-phosphate O-acyltransferase 6), an enzyme involved in triglyceride synthesis [70], Marcks (Myristoylated alanine rich protein kinase C substrate), cytoskeletal protein involved in cell adhesion and cell motility [71], Obfc2a (Oligonucleotide/oligosaccharide-binding fold containing 2A), a single stranded nucleic-acid-binding protein [72], and Ppargc1a.

Prednisolone-induced changes in gene expression in WT and GRdim mice were validated by Q-PCR for Fam107a, Dusp1, Cdkn1a and Car8. Figure 6 shows the fold-changes of the selected genes in prednisolone versus vehicle-treated WT and GRdim mice. For all four genes, the regulation by prednisolone in WT and GRdim mice was qualitatively similar to what was found by microarray analysis.

Discussion and Conclusion

In this study we performed liver gene expression profiling of WT and GRdim mice after prednisolone administration. Our aim was to chart the biological processes in the liver that are affected by GCs and to study their dependence on DNA-binding and dimerization of the GR. CoPub keyword enrichment analysis with prednisolone-regulated genes in WT mice showed enrichment of keywords associated with glucose, lipid and amino acid metabolism, the cell cycle and apoptosis (Table 1 and Figure 3). This is in agreement with cellular processes known to be affected by GCs [73,74]. Interestingly, the forkhead transcription factors Foxo1 and Foxo3a are regulators of these cellular processes and induced by prednisolone in WT mice. Together with the observation that a subset of the prednisolone-induced genes are Foxo1 and Foxo3a target genes and are similarly regulated in Foxo1 and Foxo3a expression profiling experiments [54,59,60], this suggests that the GR synergizes with these transcription factors in mouse liver to control lipid and glucose metabolism and the cell cycle. This concept is further supported by the recent finding that the MurF1 (Muscle RING finger 1) promoter contains adjacent binding sites for the GR and Foxo transcription factors and is synergistically activated when both are co-expressed [75]. However, it is likely that a subset of the prednisolone-induced genes is under direct control of Foxo1 and Foxo3a without the need for synergy with the GR. Other studies, addressing small gene sets or individual genes, had also identified a role for Foxo1 and Foxo3a in GR-induced gene expression [58,75-77].

The list of differentially regulated genes by prednisolone in WT mice overlaps with that of an earlier study by Phuc Le et al, which combined chromatin immunoprecipitation (ChIP) data with gene expression data to identify direct GR target genes in mouse liver [78]. Most of the genes found in our study displayed the same up and downregulation of gene expression, such as Tat, Foxo1 and Fkbp5 that are upregulated and Adipor2, CCAAT/enhancer binding protein alpha (C/EBPα) and Tkt that are downregulated. From a candidate gene set of 302 genes, Phuc Le et al identified metabolism, cell proliferation and programmed cell death as important processes in their GO-term analysis, which is in agreement with our findings.

Interestingly, in contrast to our study, Phuc Le et al did not observe upregulation of bona fide GR target genes, such as Pck and Igfpb in fed CD1 mice and explain this by lack of response due to a potential inhibition by insulin signaling in the fed state [79]. The fact that we observed upregulation of these genes indicates that in our experimental setup, which differs in several aspects from the setup used by Phuc Le et al, such as mouse strain used for the study, GC dosage and the fed state of the mice, the inhibitory effects of fed-induced insulin signaling do not play a role.

The overall induction of gene expression was strongly reduced in prednisolone-treated GRdim mice compared to WT mice (Figure 4). Nevertheless, in many cases residual gene induction by prednisolone was still observed. This indicates that GR dimerization is indeed an important mechanism for activation of these genes, although some regulation can take place even in the absence of GR homodimers. In fact, GR monomers are in principle capable of binding to GC response elements (GREs) and evoking a basal induction of gene expression. However, due to the lack of cooperative binding they are less potent than GR homodimers. This is in line with the regulation reported for Pnmt (Phenylethanolamine-N-methyltransferase) and Amy2 in which binding of GR monomers to GREs or a GRE half-site (i.e. only one-half of the classical palindrome) was sufficient to confer induction by GCs [80,81]. In case of the Pnmt gene, multiple GRE half-site have been identified in the promoter region allowing receptor clustering and thereby stable binding of GR monomers independent of the DNA-binding domain (DBD) interface [80]. This also explains why expression of the Pnmt gene is not compromised in GRdim mice despite the lack of GR dimer formation [21]. Another explanation for the residual gene induction by prednisolone in GRdim mice is that the mutant GR still forms homodimers but that these are far less stable than in WT mice.

A recent study showed that the specific sequence of a GRE differently affects the conformation of the GR and thereby its activity towards specific target genes [82]. Mutation analysis of overexpressed GR domains that are involved in transcriptional activation, namely the dimerization region in the DBD (Dim) as well as AF1 and AF2 (activation function 1 and 2), showed that the dependency on each of them was specific for the sequence of the GR binding site and that genes differed in their dependence on dimerization [82]. The fold induction of Tat and Fkbp5 by dexamethasone in the Dim mutant was around 30% for Tat and 50% for Fkbp5 of that for WT GR, which is in gross agreement with our own observations in vivo (Figure 4).

The effect of the GRdim mutation was found in all major pathways that were induced by prednisolone, i.e. for genes in inflammatory pathways, gluconeogenesis and cell cycle. Moreover, the attenuating effect of the GRdim mutation was found for genes that were upregulated as well as for genes that were downregulated by prednisolone. This suggests that genes, which fail to be repressed by prednisolone in GRdim mice, are either regulated through GR binding to negative GRE elements (nGREs) or indirectly regulated via other GR target genes. Interestingly, analysis of the magnitude of gene regulation by prednisolone in WT mice compared to GRdim mice showed that the cell cycle-related genes are more dependent on the dim interface than genes related to gluconeogenesis (Table 2 and 3). This can also be appreciated in Figure 4; several genes that are on the x-axis (i.e. show no differential gene expression upon prednisolone treatment in GRdim mice), are cell cycle-related.

We identified several genes that showed strong upregulation by prednisolone in GRdim mice compared to WT mice, such as Amy2, Car8 and Zdhhc23, and several genes that showed equal induction of gene expression by prednisolone in WT and GRdim mice, amongst them are Dst and Ppargc1a (Figure 4). These genes are potential candidates for having GRE half-sites in their promotor regions, which could explain why these genes show equal or even higher induction of gene expression by prednisolone compared to WT mice. As mentioned earlier, the presence of GR half-sites in the promotor region for Amy2 was indeed experimentally confirmed [81]. For the other genes however, we did not find literature evidence for the presence of GR half-sites in their promotor regions. Therefore, follow-up studies on these genes to determine the functional GRE sites in their regulatory region would be of interest to study the significance of dimer-interface independent GRE binding. Genes that showed equal or stronger upregulation by prednisolone in GRdim mice compared to WT mice can also be secondary response genes; under transcriptional control of transcription factors other than the GR. Keyword enrichment analysis performed with this set of genes did not identify enrichment for a particular cellular process.

We identified several genes that are absolutely dependent on GR dimerization for the induction of gene expression by prednisolone, such as Cdkn1a, Gadd45b, Dusp1, Plk3 and Foxo3a (Figure 4). Interestingly, all of these have a strong relationship with p53: some are under direct transcriptional control of p53 (Cdkn1a [83], Gadd45b [84] and Dusp1 [48]) or physically interact with p53 (Foxo3a [85,86] and Plk3 [87]). The cellular responses mediated by Foxo3a and p53 are highly similar, share some of their target genes (e.g. Cdkn1a and Gadd45b) and use similar mechanisms to regulate post-translational modification [51,88]. Therefore, Foxo3a and p53 can be regarded as partners that positively as well as negatively regulate each other, depending on the context [51]. This observation might indicate that GC-induced activation of Foxo3a and/or p53 is hampered in GRdim mice. In line with this hypothesis Foxo3a was recently shown to be required for GC-induced apoptosis in lymphocytes [89]. Interestingly, this process is defective in GRdim mice highlighting a possible link between the GR, Foxo3a and induction of lymphocyte apoptosis [21].

Fam107a showed the largest induction of gene expression by prednisolone in WT mice (Figure 4 and 5). Analysis of protein-protein interactions revealed that Fam107a interacts with Tada2a [90,91], a protein that together with binding partner Tada3a (Transcriptional adaptor 2 and 3 alpha) are core proteins of the histone acetyltransferase (HAT) complex [92]. HAT complexes are involved in chromatin structure modification for initiation of gene transcription, but can also acetylate non-histone proteins to modify their activity and stability [92,93]. Interestingly, Fam107b a paralog of Fam107a with 84% protein similarity (not regulated in mouse liver by prednisolone) was shown to interact with Tada3a [94].

The observation that Fam107a inhibits cell proliferation and induces apoptosis when overexpressed [65,67], suggests that Fam107a, like Foxo3a, Dusp1, Gadd45b, Cdkn1a and Plk3 play a role in regulating the cell cycle. Furthermore, the association of Fam107a with a core protein of the HAT complex might indicate that Fam107a may serve as a cofactor in the transcription machinery complex.

The activity and function of Foxo3a and p53 are strongly modulated by acetylation [51,88,95]. Hence, Fam107a is an interesting candidate gene for follow up experiments to study whether it modulates GR-induced gene expression and/or acetylation of GR-associated transcription factors such as Foxo3a, p53, C/EBPα and C/EBPβ (CCAAT/enhancer binding protein, beta).

For a more comprehensive view on GC regulated process in the liver, experiments with multiple time points, different doses of GCs and using one or more inflammatory stimuli, could be considered.

Methods

Animals

All mice (WT and GRdim; Balb/c) were bred at the Institute of Virology and Immunobiology at the University of Würzburg. In total 24 mice (8 male WT, 4 female WT, 8 male GRdim and 4 female GRdim) were included in the study. Mice were treated subcutaneously with 1 mg/kg prednisolone (5% DMSO and 5% Chremophor in manitol, 10 ml/kg) once and sacrificed 150 minutes later by cervical dislocation, which was approved by the responsible authorities in Bavaria (Regierung von Unterfranken). All experiments were performed in the morning between 9 and 10 AM. The mice were exposed to a regular dark-light-cycle (lights on between 6 AM and 6 PM) and had access to water and food ad libitum at any time.

RNA isolation

Liver biopsy specimens were collected into aluminum containers, snap freezed in liqN2 and stored at -80°C before use. RNA isolation was done using Trizol, followed by RNeasy clean-up to enhance the A260/A230 ratio. RNA quantity and quality was determined using the NanoDrop Spectrophotometer and Agilent Bioanalyzer. For all samples subjected to microarray hybridization, the RIN (RNA integrity number) was 9.0 - 10.

Microarray data processing

Processed RNA samples were hybridized on GeneChip Mouse Genome 430 2.0 arrays (MOE430-2) from Affymetrix [96]. Processing and downstream statistical analysis of the microarray data was done using the R Statistics package [97]. Data were normalized using the gcrma algorithm, pair-wise ratios between treatments were built using the limma package and annotation for the probe sets was derived from the mouse4302 library, all as provided in BioConductor [98]. In all contrast matrices, a correction for gender type was applied. Data were deposited in the NCBI Gene Expression Omnibus (GEO), accession number GSE21048.

Keyword enrichment analysis

Keyword enrichment analysis on the microarray data was performed using CoPub [34] with default settings as provided by the web server [99]. The literature-network between enriched keywords and genes (nodes) and their co-publications (edges) were visualized using Cytoscape software [100,101].

Validation of microarray results with Q-PCR

Total RNA (1 μg) was reverse transcribed using a commercially available cDNA synthesis kit (iScript, BioRad Laboratories, Hercules, CA, USA). Q-PCR was performed by SYBR Green-based quantification according to the manufacturer's protocol (Applied Biosystems, Foster City, CA, USA). Primers were developed for Fam107a (Family with sequence similarity 107, member a; Fw:TCATCAAACCCAAGAAGCTG; Rev: CTCAGGCTTGCTGTCCATAC), Car8 (Carbonic anhydrase 8; Fw: CACACCATTCAAGTCATCCTG; Rev: ACCACGCTGGTTTTCTCTTC), Cdkn1a (Cyclin-dependent kinase inhibitor 1a; Fw: TCTTGCACTCTGGTGTCTGAG; Rev: ATCTGCGCTTGGAGTGATAG) and Dusp1 (Dual specificity phosphatase 1; Fw: GTGCCTGACAGTGCAGAATC; Rev: CCAGGTACAGGAAGGACAGG) using Primer3 [102]. All primer pairs were exon-spanning. The gene Azgp1 (alpha-2-glycoprotein 1, zinc-binding; Fw: AAGGAAAGCCAGCTTCAGAG; Rev: ACCAAACATTCCCTGAAAGG) was chosen as endogenous control since the expression arrays did not show any differences in expression of this gene between the two experimental groups (WT vs GRdim). PCR products were selected to be between 80 and 120 bp long. Samples were run on the 7500 Fast Real-Time PCR System (Applied Biosystems) using the following protocol: 10 min. denaturation at 95°C, and 40 cycles of 15 sec. denaturation at 95°C, 60 sec. annealing and extension at 60°C. All primer pairs were validated in triplicate using serial cDNA dilutions. Primer pairs that were 100 ± 10% efficient, which implies a doubling of PCR product in each cycle, were used to quantify mRNA levels. Threshold cycle numbers (referred to as Ct) were obtained using the 7900 HT System SDS software version 2.3 (Applied Biosystems). All samples were measured for three times and samples with a standard deviation (SD) larger than 0.5 were excluded from the analysis. The relative quantity (RQ) of the gene-specific mRNA was calculated from the average value of the ΔCt (target gene Ct - endogenous control gene Ct) for each of the 24 analyzed samples. Differences in expression between two samples were calculated by the 2ΔΔCt method [103,104]. For Q-PCR, mean differences in expression between groups were analyzed using the Student's t-test. A p-value of < 0.05 was considered statistically significant in each situation.

Protein - protein interaction data

Protein-protein interaction data were retrieved from the Biological General Repository for Interaction Datasets (BioGRID) database [105,106].

Abbreviations

GR: Glucocorticoid receptor; WT: Wild type; GRdim: GR with the A458T point mutation in the dimerization region of the DNA-binding domain; GCs: Glucocorticoids; GRE: Glucocorticoid response element.

Authors' contributions

RF, AvE, MJvL, JPT, HMR, WD, JdV and WA designed research. JPT and HMR generated and provided GRdim and WT mice. HvdM performed RNA isolations and microarray hybridization experiments. EJMT designed and performed Q-PCR experiments. RF, WF and WA analyzed the microarray data and wrote the paper. All authors read and approved the final manuscript.

Acknowledgements

WF is sponsored by a grant received from the Netherlands Bioinformatics Centre (NBIC) under de BioRange program.

References

  1. Kirwan J, Power L: Glucocorticoids: action and new therapeutic insights in rheumatoid arthritis.

    Curr Opin Rheumatol 2007, 19:233-237. PubMed Abstract | Publisher Full Text OpenURL

  2. Ito K, Getting SJ, Charron CE: Mode of glucocorticoid actions in airway disease.

    ScientificWorldJournal 2006, 6:1750-1769. PubMed Abstract | Publisher Full Text OpenURL

  3. Ito K, Chung KF, Adcock IM: Update on glucocorticoid action and resistance.

    J Allergy Clin Immunol 2006, 117:522-543. PubMed Abstract | Publisher Full Text OpenURL

  4. Schacke H, Docke WD, Asadullah K: Mechanisms involved in the side effects of glucocorticoids.

    Pharmacol Ther 2002, 96:23-43. PubMed Abstract | Publisher Full Text OpenURL

  5. Zhou J, Cidlowski JA: The human glucocorticoid receptor: one gene, multiple proteins and diverse responses.

    Steroids 2005, 70:407-417. PubMed Abstract | Publisher Full Text OpenURL

  6. Schoneveld OJ, Gaemers IC, Lamers WH: Mechanisms of glucocorticoid signalling.

    Biochim Biophys Acta 2004, 1680:114-128. PubMed Abstract | Publisher Full Text OpenURL

  7. Newton R, Holden NS: Separating transrepression and transactivation: a distressing divorce for the glucocorticoid receptor?

    Mol Pharmacol 2007, 72:799-809. PubMed Abstract | Publisher Full Text OpenURL

  8. De Bosscher K, Vanden Berghe W, Haegeman G: The interplay between the glucocorticoid receptor and nuclear factor-kappaB or activator protein-1: molecular mechanisms for gene repression.

    Endocr Rev 2003, 24:488-522. PubMed Abstract | Publisher Full Text OpenURL

  9. Hermoso MA, Cidlowski JA: Putting the brake on inflammatory responses: the role of glucocorticoids.

    IUBMB Life 2003, 55:497-504. PubMed Abstract | Publisher Full Text OpenURL

  10. Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, Cato AC: A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the transcription factor AP-1.

    EMBO J 1994, 13:4087-4095. PubMed Abstract | PubMed Central Full Text OpenURL

  11. Scheinman RI, Gualberto A, Jewell CM, Cidlowski JA, Baldwin AS Jr: Characterization of mechanisms involved in transrepression of NF-kappa B by activated glucocorticoid receptors.

    Mol Cell Biol 1995, 15:943-953. PubMed Abstract | PubMed Central Full Text OpenURL

  12. Lucibello FC, Slater EP, Jooss KU, Beato M, Muller R: Mutual transrepression of Fos and the glucocorticoid receptor: involvement of a functional domain in Fos which is absent in FosB.

    EMBO J 1990, 9:2827-2834. PubMed Abstract | PubMed Central Full Text OpenURL

  13. Adcock IM, Ito K, Barnes PJ: Glucocorticoids: effects on gene transcription.

    Proc Am Thorac Soc 2004, 1:247-254. PubMed Abstract | Publisher Full Text OpenURL

  14. Ray A, Prefontaine KE: Physical association and functional antagonism between the p65 subunit of transcription factor NF-kappa B and the glucocorticoid receptor.

    Proc Natl Acad Sci USA 1994, 91:752-756. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  15. Heck S, Bender K, Kullmann M, Gottlicher M, Herrlich P, Cato AC: I kappaB alpha-independent downregulation of NF-kappaB activity by glucocorticoid receptor.

    EMBO J 1997, 16:4698-4707. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  16. Reily MM, Pantoja C, Hu X, Chinenov Y, Rogatsky I: The GRIP1:IRF3 interaction as a target for glucocorticoid receptor-mediated immunosuppression.

    EMBO J 2006, 25:108-117. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  17. Tuckermann JP, Kleiman A, Moriggl R, Spanbroek R, Neumann A, Illing A, Clausen BE, Stride B, Forster I, Habenicht AJ, Reichardt HM, Tronche F, Schmid W, Schutz G: Macrophages and neutrophils are the targets for immune suppression by glucocorticoids in contact allergy.

    J Clin Invest 2007, 117:1381-1390. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  18. Opherk C, Tronche F, Kellendonk C, Kohlmuller D, Schulze A, Schmid W, Schutz G: Inactivation of the glucocorticoid receptor in hepatocytes leads to fasting hypoglycemia and ameliorates hyperglycemia in streptozotocin-induced diabetes mellitus.

    Mol Endocrinol 2004, 18:1346-1353. PubMed Abstract | Publisher Full Text OpenURL

  19. Watts LM, Manchem VP, Leedom TA, Rivard AL, McKay RA, Bao D, Neroladakis T, Monia BP, Bodenmiller DM, Cao JX, Zhang HY, Cox AL, Jacobs SJ, Michael MD, Sloop KW, Bhanot S: Reduction of hepatic and adipose tissue glucocorticoid receptor expression with antisense oligonucleotides improves hyperglycemia and hyperlipidemia in diabetic rodents without causing systemic glucocorticoid antagonism.

    Diabetes 2005, 54:1846-1853. PubMed Abstract | Publisher Full Text OpenURL

  20. Vander Kooi BT, Onuma H, Oeser JK, Svitek CA, Allen SR, Vander Kooi CW, Chazin WJ, O'Brien RM: The glucose-6-phosphatase catalytic subunit gene promoter contains both positive and negative glucocorticoid response elements.

    Mol Endocrinol 2005, 19:3001-3022. PubMed Abstract | Publisher Full Text OpenURL

  21. Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, Schmid W, Herrlich P, Angel P, Schutz G: DNA binding of the glucocorticoid receptor is not essential for survival.

    Cell 1998, 93:531-541. PubMed Abstract | Publisher Full Text OpenURL

  22. Reichardt HM, Tuckermann JP, Gottlicher M, Vujic M, Weih F, Angel P, Herrlich P, Schutz G: Repression of inflammatory responses in the absence of DNA binding by the glucocorticoid receptor.

    EMBO J 2001, 20:7168-7173. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  23. Vermeer H, Hendriks-Stegeman BI, van der Burg B, van Buul-Offers SC, Jansen M: Glucocorticoid-induced increase in lymphocytic FKBP51 messenger ribonucleic acid expression: a potential marker for glucocorticoid sensitivity, potency, and bioavailability.

    J Clin Endocrinol Metab 2003, 88:277-284. PubMed Abstract | Publisher Full Text OpenURL

  24. Alexandrova M: Stress induced tyrosine aminotransferase activity via glucocorticoid receptor.

    Horm Metab Res 1994, 26:97-99. PubMed Abstract | Publisher Full Text OpenURL

  25. Imai E, Stromstedt PE, Quinn PG, Carlstedt-Duke J, Gustafsson JA, Granner DK: Characterization of a complex glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene.

    Mol Cell Biol 1990, 10:4712-4719. PubMed Abstract | PubMed Central Full Text OpenURL

  26. Kassel O, Sancono A, Kratzschmar J, Kreft B, Stassen M, Cato AC: Glucocorticoids inhibit MAP kinase via increased expression and decreased degradation of MKP-1.

    EMBO J 2001, 20:7108-7116. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  27. Smoak KA, Cidlowski JA: Mechanisms of glucocorticoid receptor signaling during inflammation.

    Mech Ageing Dev 2004, 125:697-706. PubMed Abstract | Publisher Full Text OpenURL

  28. Tuckermann JP, Reichardt HM, Arribas R, Richter KH, Schutz G, Angel P: The DNA binding-independent function of the glucocorticoid receptor mediates repression of AP-1-dependent genes in skin.

    J Cell Biol 1999, 147:1365-1370. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  29. Rogatsky I, Luecke HF, Leitman DC, Yamamoto KR: Alternate surfaces of transcriptional coregulator GRIP1 function in different glucocorticoid receptor activation and repression contexts.

    Proc Natl Acad Sci USA 2002, 99:16701-16706. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  30. Sakuma T, Bhadhprasit W, Hashita T, Nemoto N: Synergism of glucocorticoid hormone with growth hormone for female-specific mouse Cyp3a44 gene expression.

    Drug Metab Dispos 2008, 36:878-884. PubMed Abstract | Publisher Full Text OpenURL

  31. Muller DN, Schmidt C, Barbosa-Sicard E, Wellner M, Gross V, Hercule H, Markovic M, Honeck H, Luft FC, Schunck WH: Mouse Cyp4a isoforms: enzymatic properties, gender- and strain-specific expression, and role in renal 20-hydroxyeicosatetraenoic acid formation.

    Biochem J 2007, 403:109-118. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  32. Wang JC, Derynck MK, Nonaka DF, Khodabakhsh DB, Haqq C, Yamamoto KR: Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorticoid receptor target genes.

    Proc Natl Acad Sci USA 2004, 101:15603-15608. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  33. Suh DS, Rechler MM: Hepatocyte nuclear factor 1 and the glucocorticoid receptor synergistically activate transcription of the rat insulin-like growth factor binding protein-1 gene.

    Mol Endocrinol 1997, 11:1822-1831. PubMed Abstract | Publisher Full Text OpenURL

  34. Frijters R, Heupers B, van Beek P, Bouwhuis M, van Schaik R, de Vlieg J, Polman J, Alkema W: CoPub: a literature-based keyword enrichment tool for microarray data analysis.

    Nucleic Acids Res 2008, 36:W406-410. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  35. Sun Y, Liu S, Ferguson S, Wang L, Klepcyk P, Yun JS, Friedman JE: Phosphoenolpyruvate carboxykinase overexpression selectively attenuates insulin signaling and hepatic insulin sensitivity in transgenic mice.

    J Biol Chem 2002, 277:23301-23307. PubMed Abstract | Publisher Full Text OpenURL

  36. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, Spiegelman BM: Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1.

    Nature 2001, 413:131-138. PubMed Abstract | Publisher Full Text OpenURL

  37. Hagopian K, Ramsey JJ, Weindruch R: Serine utilization in mouse liver: influence of caloric restriction and aging.

    FEBS Lett 2005, 579:2009-2013. PubMed Abstract | Publisher Full Text OpenURL

  38. Markovitz PJ, Chuang DT: The bifunctional aminoadipic semialdehyde synthase in lysine degradation. Separation of reductase and dehydrogenase domains by limited proteolysis and column chromatography.

    J Biol Chem 1987, 262:9353-9358. PubMed Abstract | Publisher Full Text OpenURL

  39. Thirone AC, Huang C, Klip A: Tissue-specific roles of IRS proteins in insulin signaling and glucose transport.

    Trends Endocrinol Metab 2006, 17:72-78. PubMed Abstract | Publisher Full Text OpenURL

  40. Beutler E, Baronciani L: Mutations in pyruvate kinase.

    Hum Mutat 1996, 7:1-6. PubMed Abstract | Publisher Full Text OpenURL

  41. Scott DK, Stromstedt PE, Wang JC, Granner DK: Further characterization of the glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. The role of the glucocorticoid receptor-binding sites.

    Mol Endocrinol 1998, 12:482-491. PubMed Abstract | Publisher Full Text OpenURL

  42. Barthel A, Schmoll D: Novel concepts in insulin regulation of hepatic gluconeogenesis.

    Am J Physiol Endocrinol Metab 2003, 285:E685-692. PubMed Abstract | Publisher Full Text OpenURL

  43. Liebermann DA, Hoffman B: Gadd45 in stress signaling.

    J Mol Signal 2008, 3:15. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  44. Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D: p21 is a universal inhibitor of cyclin kinases.

    Nature 1993, 366:701-704. PubMed Abstract | Publisher Full Text OpenURL

  45. Bahassi el M, Conn CW, Myer DL, Hennigan RF, McGowan CH, Sanchez Y, Stambrook PJ: Mammalian Polo-like kinase 3 (Plk3) is a multifunctional protein involved in stress response pathways.

    Oncogene 2002, 21:6633-6640. PubMed Abstract | Publisher Full Text OpenURL

  46. Brunelle JK, Letai A: Control of mitochondrial apoptosis by the Bcl-2 family.

    J Cell Sci 2009, 122:437-441. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  47. Smith GB, Mocarski ES: Contribution of GADD45 family members to cell death suppression by cellular Bcl-xL and cytomegalovirus vMIA.

    J Virol 2005, 79:14923-14932. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  48. Li M, Zhou JY, Ge Y, Matherly LH, Wu GS: The phosphatase MKP1 is a transcriptional target of p53 involved in cell cycle regulation.

    J Biol Chem 2003, 278:41059-41068. PubMed Abstract | Publisher Full Text OpenURL

  49. Sherr CJ: G1 phase progression: cycling on cue.

    Cell 1994, 79:551-555. PubMed Abstract | Publisher Full Text OpenURL

  50. Rother K, Dengl M, Lorenz J, Tschop K, Kirschner R, Mossner J, Engeland K: Gene expression of cyclin-dependent kinase subunit Cks2 is repressed by the tumor suppressor p53 but not by the related proteins p63 or p73.

    FEBS Lett 2007, 581:1166-1172. PubMed Abstract | Publisher Full Text OpenURL

  51. van der Horst A, Burgering BM: Stressing the role of FoxO proteins in lifespan and disease.

    Nat Rev Mol Cell Biol 2007, 8:440-450. PubMed Abstract | Publisher Full Text OpenURL

  52. Arden KC: FOXO animal models reveal a variety of diverse roles for FOXO transcription factors.

    Oncogene 2008, 27:2345-2350. PubMed Abstract | Publisher Full Text OpenURL

  53. Nakae J, Oki M, Cao Y: The FoxO transcription factors and metabolic regulation.

    FEBS Lett 2008, 582:54-67. PubMed Abstract | Publisher Full Text OpenURL

  54. Furukawa-Hibi Y, Kobayashi Y, Chen C, Motoyama N: FOXO transcription factors in cell-cycle regulation and the response to oxidative stress.

    Antioxid Redox Signal 2005, 7:752-760. PubMed Abstract | Publisher Full Text OpenURL

  55. Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura Y, Altomonte J, Dong H, Accili D, Spiegelman BM: Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction.

    Nature 2003, 423:550-555. PubMed Abstract | Publisher Full Text OpenURL

  56. Dong XC, Copps KD, Guo S, Li Y, Kollipara R, DePinho RA, White MF: Inactivation of hepatic Foxo1 by insulin signaling is required for adaptive nutrient homeostasis and endocrine growth regulation.

    Cell Metab 2008, 8:65-76. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  57. Barthel A, Schmoll D, Kruger KD, Bahrenberg G, Walther R, Roth RA, Joost HG: Differential regulation of endogenous glucose-6-phosphatase and phosphoenolpyruvate carboxykinase gene expression by the forkhead transcription factor FKHR in H4IIE-hepatoma cells.

    Biochem Biophys Res Commun 2001, 285:897-902. PubMed Abstract | Publisher Full Text OpenURL

  58. Nakae J, Kitamura T, Silver DL, Accili D: The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression.

    J Clin Invest 2001, 108:1359-1367. PubMed Abstract | PubMed Central Full Text OpenURL

  59. Zhang W, Patil S, Chauhan B, Guo S, Powell DR, Le J, Klotsas A, Matika R, Xiao X, Franks R, Heidenreich KA, Sajan MP, Farese RV, Stolz DB, Tso P, Koo SH, Montminy M, Unterman TG: FoxO1 regulates multiple metabolic pathways in the liver: effects on gluconeogenic, glycolytic, and lipogenic gene expression.

    J Biol Chem 2006, 281:10105-10117. PubMed Abstract | Publisher Full Text OpenURL

  60. Gomis RR, Alarcon C, He W, Wang Q, Seoane J, Lash A, Massague J: A FoxO-Smad synexpression group in human keratinocytes.

    Proc Natl Acad Sci USA 2006, 103:12747-12752. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  61. Nishikata M, Nishimori I, Taniuchi K, Takeuchi T, Minakuchi T, Kohsaki T, Adachi Y, Ohtsuki Y, Onishi S: Carbonic anhydrase-related protein VIII promotes colon cancer cell growth.

    Mol Carcinog 2007, 46:208-214. PubMed Abstract | Publisher Full Text OpenURL

  62. Saitoh F, Tian QB, Okano A, Sakagami H, Kondo H, Suzuki T: NIDD, a novel DHHC-containing protein, targets neuronal nitric-oxide synthase (nNOS) to the synaptic membrane through a PDZ-dependent interaction and regulates nNOS activity.

    J Biol Chem 2004, 279:29461-29468. PubMed Abstract | Publisher Full Text OpenURL

  63. Brasier G, Tikellis C, Xuereb L, Craigie J, Casley D, Kovacs CS, Fudge NJ, Kalnins R, Cooper ME, Wookey PJ: Novel hexad repeats conserved in a putative transporter with restricted expression in cell types associated with growth, calcium exchange and homeostasis.

    Exp Cell Res 2004, 293:31-42. PubMed Abstract | Publisher Full Text OpenURL

  64. Yamato T, Orikasa K, Fukushige S, Orikasa S, Horii A: Isolation and characterization of the novel gene, TU3A, in a commonly deleted region on 3p14.3-->p14.2 in renal cell carcinoma.

    Cytogenet Cell Genet 1999, 87:291-295. PubMed Abstract | Publisher Full Text OpenURL

  65. Wang L, Darling J, Zhang JS, Liu W, Qian J, Bostwick D, Hartmann L, Jenkins R, Bardenhauer W, Schutte J, Opalka B, Smith DI: Loss of expression of the DRR 1 gene at chromosomal segment 3p21.1 in renal cell carcinoma.

    Genes Chromosomes Cancer 2000, 27:1-10. PubMed Abstract | Publisher Full Text OpenURL

  66. Awakura Y, Nakamura E, Ito N, Kamoto T, Ogawa O: Methylation-associated silencing of TU3A in human cancers.

    Int J Oncol 2008, 33:893-899. PubMed Abstract | Publisher Full Text OpenURL

  67. Liu Q, Zhao XY, Bai RZ, Liang SF, Nie CL, Yuan Z, Wang CT, Wu Y, Chen LJ, Wei YQ: Induction of tumor inhibition and apoptosis by a candidate tumor suppressor gene DRR1 on 3p21.1.

    Oncol Rep 2009, 22:1069-1075. PubMed Abstract | Publisher Full Text OpenURL

  68. Young KG, Pinheiro B, Kothary R: A Bpag1 isoform involved in cytoskeletal organization surrounding the nucleus.

    Exp Cell Res 2006, 312:121-134. PubMed Abstract | Publisher Full Text OpenURL

  69. Nakadai T, Shimada M, Shima D, Handa H, Tamura TA: Specific interaction with transcription factor IIA and localization of the mammalian TATA-binding protein-like protein (TLP/TRF2/TLF).

    J Biol Chem 2004, 279:7447-7455. PubMed Abstract | Publisher Full Text OpenURL

  70. Vergnes L, Beigneux AP, Davis R, Watkins SM, Young SG, Reue K: Agpat6 deficiency causes subdermal lipodystrophy and resistance to obesity.

    J Lipid Res 2006, 47:745-754. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  71. Arbuzova A, Schmitz AA, Vergeres G: Cross-talk unfolded: MARCKS proteins.

    Biochem J 2002, 362:1-12. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  72. Kang HS, Beak JY, Kim YS, Petrovich RM, Collins JB, Grissom SF, Jetten AM: NABP1, a novel RORgamma-regulated gene encoding a single-stranded nucleic-acid-binding protein.

    Biochem J 2006, 397:89-99. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  73. Rogatsky I, Trowbridge JM, Garabedian MJ: Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    Mol Cell Biol 1997, 17:3181-3193. PubMed Abstract | PubMed Central Full Text OpenURL

  74. Sionov RV, Kfir S, Zafrir E, Cohen O, Zilberman Y, Yefenof E: Glucocorticoid-induced apoptosis revisited: a novel role for glucocorticoid receptor translocation to the mitochondria.

    Cell Cycle 2006, 5:1017-1026. PubMed Abstract | Publisher Full Text OpenURL

  75. Waddell DS, Baehr LM, van den Brandt J, Johnsen SA, Reichardt HM, Furlow JD, Bodine SC: The glucocorticoid receptor and FOXO1 synergistically activate the skeletal muscle atrophy-associated MuRF1 gene.

    Am J Physiol Endocrinol Metab 2008, 295:E785-797. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  76. Zhao W, Qin W, Pan J, Wu Y, Bauman WA, Cardozo C: Dependence of dexamethasone-induced Akt/FOXO1 signaling, upregulation of MAFbx, and protein catabolism upon the glucocorticoid receptor.

    Biochem Biophys Res Commun 2009, 378:668-672. PubMed Abstract | Publisher Full Text OpenURL

  77. Kwon HS, Huang B, Unterman TG, Harris RA: Protein kinase B-alpha inhibits human pyruvate dehydrogenase kinase-4 gene induction by dexamethasone through inactivation of FOXO transcription factors.

    Diabetes 2004, 53:899-910. PubMed Abstract | Publisher Full Text OpenURL

  78. Phuc Le P, Friedman JR, Schug J, Brestelli JE, Parker JB, Bochkis IM, Kaestner KH: Glucocorticoid receptor-dependent gene regulatory networks.

    PLoS Genet 2005, 1:e16. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  79. Pierreux CE, Rousseau GG, Lemaigre FP: Insulin inhibition of glucocorticoid-stimulated gene transcription: requirement for an insulin response element?

    Mol Cell Endocrinol 1999, 147:1-5. PubMed Abstract | Publisher Full Text OpenURL

  80. Adams M, Meijer OC, Wang J, Bhargava A, Pearce D: Homodimerization of the glucocorticoid receptor is not essential for response element binding: activation of the phenylethanolamine N-methyltransferase gene by dimerization-defective mutants.

    Mol Endocrinol 2003, 17:2583-2592. PubMed Abstract | Publisher Full Text OpenURL

  81. Slater EP, Hesse H, Muller JM, Beato M: Glucocorticoid receptor binding site in the mouse alpha-amylase 2 gene mediates response to the hormone.

    Mol Endocrinol 1993, 7:907-914. PubMed Abstract | Publisher Full Text OpenURL

  82. Meijsing SH, Pufall MA, So AY, Bates DL, Chen L, Yamamoto KR: DNA binding site sequence directs glucocorticoid receptor structure and activity.

    Science 2009, 324:407-410. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  83. Hill R, Bodzak E, Blough MD, Lee PW: p53 Binding to the p21 promoter is dependent on the nature of DNA damage.

    Cell Cycle 2008, 7:2535-2543. PubMed Abstract | Publisher Full Text OpenURL

  84. Balliet AG, Hatton KS, Hoffman B, Liebermann DA: Comparative analysis of the genetic structure and chromosomal location of the murine MyD118 (Gadd45beta) gene.

    DNA Cell Biol 2001, 20:239-247. PubMed Abstract | Publisher Full Text OpenURL

  85. Nemoto S, Fergusson MM, Finkel T: Nutrient availability regulates SIRT1 through a forkhead-dependent pathway.

    Science 2004, 306:2105-2108. PubMed Abstract | Publisher Full Text OpenURL

  86. Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, Tran H, Ross SE, Mostoslavsky R, Cohen HY, Hu LS, Cheng HL, Jedrychowski MP, Gygi SP, Sinclair DA, Alt FW, Greenberg ME: Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase.

    Science 2004, 303:2011-2015. PubMed Abstract | Publisher Full Text OpenURL

  87. Xie S, Wu H, Wang Q, Cogswell JP, Husain I, Conn C, Stambrook P, Jhanwar-Uniyal M, Dai W: Plk3 functionally links DNA damage to cell cycle arrest and apoptosis at least in part via the p53 pathway.

    J Biol Chem 2001, 276:43305-43312. PubMed Abstract | Publisher Full Text OpenURL

  88. Spange S, Wagner T, Heinzel T, Kramer OH: Acetylation of non-histone proteins modulates cellular signalling at multiple levels.

    Int J Biochem Cell Biol 2009, 41:185-198. PubMed Abstract | Publisher Full Text OpenURL

  89. Ma J, Xie Y, Shi Y, Qin W, Zhao B, Jin Y: Glucocorticoid-induced apoptosis requires FOXO3A activity.

    Biochem Biophys Res Commun 2008, 377:894-898. PubMed Abstract | Publisher Full Text OpenURL

  90. Rual JF, Venkatesan K, Hao T, Hirozane-Kishikawa T, Dricot A, Li N, Berriz GF, Gibbons FD, Dreze M, Ayivi-Guedehoussou N, Klitgord N, Simon C, Boxem M, Milstein S, Rosenberg J, Goldberg DS, Zhang LV, Wong SL, Franklin G, Li S, Albala JS, Lim J, Fraughton C, Llamosas E, Cevik S, Bex C, Lamesch P, Sikorski RS, Vandenhaute J, Zoghbi HY, et al.: Towards a proteome-scale map of the human protein-protein interaction network.

    Nature 2005, 437:1173-1178. PubMed Abstract | Publisher Full Text OpenURL

  91. Ewing RM, Chu P, Elisma F, Li H, Taylor P, Climie S, McBroom-Cerajewski L, Robinson MD, O'Connor L, Li M, Taylor R, Dharsee M, Ho Y, Heilbut A, Moore L, Zhang S, Ornatsky O, Bukhman YV, Ethier M, Sheng Y, Vasilescu J, Abu-Farha M, Lambert JP, Duewel HS, Stewart II, Kuehl B, Hogue K, Colwill K, Gladwish K, Muskat B, et al.: Large-scale mapping of human protein-protein interactions by mass spectrometry.

    Mol Syst Biol 2007, 3:89. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  92. Wang YL, Faiola F, Xu M, Pan S, Martinez E: Human ATAC Is a GCN5/PCAF-containing acetylase complex with a novel NC2-like histone fold module that interacts with the TATA-binding protein.

    J Biol Chem 2008, 283:33808-33815. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  93. Nagy Z, Tora L: Distinct GCN5/PCAF-containing complexes function as co-activators and are involved in transcription factor and global histone acetylation.

    Oncogene 2007, 26:5341-5357. PubMed Abstract | Publisher Full Text OpenURL

  94. Stelzl U, Worm U, Lalowski M, Haenig C, Brembeck FH, Goehler H, Stroedicke M, Zenkner M, Schoenherr A, Koeppen S, Timm J, Mintzlaff S, Abraham C, Bock N, Kietzmann S, Goedde A, Toksoz E, Droege A, Krobitsch S, Korn B, Birchmeier W, Lehrach H, Wanker EE: A human protein-protein interaction network: a resource for annotating the proteome.

    Cell 2005, 122:957-968. PubMed Abstract | Publisher Full Text OpenURL

  95. Kruse JP, Gu W: Modes of p53 regulation.

    Cell 2009, 137:609-622. PubMed Abstract | Publisher Full Text OpenURL

  96. Affymetrix[http://www.affymetrix.com] webcite

  97. The R Project for Statistical Computing[http://www.r-project.org] webcite

  98. BioConductor[http://www.bioconductor.org] webcite

  99. CoPub web server[http://www.copub.org] webcite

  100. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T: Cytoscape: a software environment for integrated models of biomolecular interaction networks.

    Genome Res 2003, 13:2498-2504. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  101. Cytoscape: Analyzing and Visualizing Network Data. [http://www.cytoscape.org] webcite

  102. Rozen S, Skaletsky H: Primer3 on the www for general users and for biologist programmers.

    Methods Mol Biol 2000, 132:365-386. PubMed Abstract OpenURL

  103. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

    Methods 2001, 25:402-408. PubMed Abstract | Publisher Full Text OpenURL

  104. Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR.

    Nucleic Acids Res 2001, 29:e45. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  105. Breitkreutz BJ, Stark C, Reguly T, Boucher L, Breitkreutz A, Livstone M, Oughtred R, Lackner DH, Bahler J, Wood V, Dolinski K, Tyers M: The BioGRID Interaction Database: 2008 update.

    Nucleic Acids Res 2008, 36:D637-640. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  106. The BioGRID[http://www.thebiogrid.org] webcite