Table 1

Differentially regulated Zur target genes preceded by candidate Zur-binding sites in C. glutamicum ATCC 13032.

CDS

Gene

Predicted function

21-bp motif1

Differential gene expression2

Array

RT-PCR


cg0040

-

secreted protein

-

3.34

4.5

cg0041

znuA2

ABC-type Zn/Mn transporter, substrate-binding protein

-

5.68

27900

cg00423

znuB2

ABC-type Zn/Mn transporter, permease subunit

TAATGATAACGGTTATCATTT

2.25

331

cg0043

znuC2

ABC-type Zn/Mn transporter, ATPase subunit

AAATGATAACCGTTATCATTA

2.13

50.2

cg0794

yciC

P-loop GTPase of the COG0523 family

TATTGAAAATGATTCCCAAAA

2.75

10.5

cg0795

-

oxidoreductase

TAATGGAAATTGTTTTCAATA

5.43

45500

cg29114

znuA1

ABC-type Zn/Mn transporter, substrate-binding protein

TGTTGACATCCTTTTTCAATA

3.52

43.8

cg2912

znuC1

ABC-type Zn/Mn transporter, ATPase subunit

-

2.79

75.8

cg2913

znuB1

ABC-type Zn/Mn transporter, permease subunit

-

1.29

29.0


1 Genes listed without 21-bp motif (-) belong to predicted operons.

2 The gene expression in C. glutamicum JS2502 was compared with that of the wild-type strain ATCC 13032. Array, m-values obtained by DNA microarray hybridizations (intensity ratio); RT-PCR, values obtained by RT-PCR (relative expression).

3 First gene of the putative cg0042-cg0041-cg0040 operon.

4 First gene of the putative cg2911-cg2912-cg2913 operon.

Schröder et al. BMC Genomics 2010 11:12   doi:10.1186/1471-2164-11-12

Open Data