Table 1 |
|||||
|
Differentially regulated Zur target genes preceded by candidate Zur-binding sites in C. glutamicum ATCC 13032. |
|||||
|
CDS |
Gene |
Predicted function |
21-bp motif1 |
Differential gene expression2 |
|
|
Array |
RT-PCR |
||||
|
|
|||||
|
cg0040 |
- |
secreted protein |
- |
3.34 |
4.5 |
|
cg0041 |
znuA2 |
ABC-type Zn/Mn transporter, substrate-binding protein |
- |
5.68 |
27900 |
|
cg00423 |
znuB2 |
ABC-type Zn/Mn transporter, permease subunit |
TAATGATAACGGTTATCATTT |
2.25 |
331 |
|
cg0043 |
znuC2 |
ABC-type Zn/Mn transporter, ATPase subunit |
AAATGATAACCGTTATCATTA |
2.13 |
50.2 |
|
cg0794 |
yciC |
P-loop GTPase of the COG0523 family |
TATTGAAAATGATTCCCAAAA |
2.75 |
10.5 |
|
cg0795 |
- |
oxidoreductase |
TAATGGAAATTGTTTTCAATA |
5.43 |
45500 |
|
cg29114 |
znuA1 |
ABC-type Zn/Mn transporter, substrate-binding protein |
TGTTGACATCCTTTTTCAATA |
3.52 |
43.8 |
|
cg2912 |
znuC1 |
ABC-type Zn/Mn transporter, ATPase subunit |
- |
2.79 |
75.8 |
|
cg2913 |
znuB1 |
ABC-type Zn/Mn transporter, permease subunit |
- |
1.29 |
29.0 |
|
|
|||||
|
1 Genes listed without 21-bp motif (-) belong to predicted operons. 2 The gene expression in C. glutamicum JS2502 was compared with that of the wild-type strain ATCC 13032. Array, m-values obtained by DNA microarray hybridizations (intensity ratio); RT-PCR, values obtained by RT-PCR (relative expression). 3 First gene of the putative cg0042-cg0041-cg0040 operon. 4 First gene of the putative cg2911-cg2912-cg2913 operon. |
|||||
|
Schröder et al. BMC Genomics 2010 11:12 doi:10.1186/1471-2164-11-12 |
|||||
