Table 2

miRNAs identified in Cx. quinquefasciatus adult female mosquitoes.

Culex

# miRNA

# miRNA*

Sequence

Length

aga

ame

dme

supercontig

Start

End

Strand


184

107190

0

UGGACGGAGAACUGAUAAGGGC

22

Y

Y

Y

3.567

240312

240333

Minus

317-1

71313

2

UGAACACAGCUGGUGGUAUCU

21

Y

Y

Y

3.36

1133209

1133229

Plus

317-2

-

-

UGAACACAGCUGGUGGUAUCU

21

Y

Y

Y

3.36

1134875

1134895

Plus

277

58628

0

UAAAUGCACUAUCUGGUACGAC

22

Y

Y

Y

3.36

1153785

1153806

Plus

1

36084

0

UGGAAUGUAAAGAAGUAUGGAG

22

Y

Y

Y

3.78

246250

246271

Plus

989

23667

0

UGUGAUGUGACGUAGUGGUAC

21

Y

?

Y

3.315

321364

321384

Plus

275

13910

2

UCAGGUACCUGAAGUAGCGC

20

Y

Y

Y

3.291

329815

329834

Plus

957

11682

0

UGAAACCGUCCAAAACUGAGGC

22

Y

?

Y

3.787

29593

29614

Plus

8-3p

10950

-

UAAUACUGUCAGGUAAAGAUGU

22

Y

Y

Y

3.40

815865

815886

Minus

281

9322

95

AAGAGAGCUAUCCGUCGACAGU

22

Y

Y

Y

3.64

99744

99765

Plus

Let-7

9266

5

UGAGGUAGUUGGUUGUAUAGU

21

Y

Y

Y

3.4

280610

280630

Plus

34

6301

3

UGGCAGUGUGGUUAGCUGGUU

21

Y

Y

Y

3.36

1154478

1154498

Plus

263

3749

2

AAUGGCACUGGAAGAAUUCACGG

23

Y

Y

Y

3.219

351848

351870

Minus

252-1

3157

2

(C)UAAGUACUAGUGCCGCAGGAG

21

Y

Y

Y

3.1787

6836

6856

Minus

252-2

-

-

(C)UAAGUACUAGUGCCGCAGGAG

21

Y

Y

Y

3.975

115594

115614

Plus

87

2364

0

GUGAGCAAAUUUUCAGGUGUGU

22

Y

Y

Y

3.431

379788

379809

Plus

71

2232

14

AGAAAGACAUGGGUAGUGAGAU

22

?

Y

?

3.366

117552

117573

Minus

bantam-5p

1459

-

CCGGUUUUCAUUUUCGAUCUGAC

21

Y

Y

Y

3.65

199737

199759

Minus

9

1138

440

UCUUUGGUAUUCUAGCUGUAGA

22

Y

Y

Y

3.83

64733

64754

Plus

11

888

5

CAUCACAGUCUGAGUUCUUGCU

22

Y

?

Y

3.153

639669

639690

Minus

276-1

860

2

UAGGAACUUCAUACCGUGCUCU

22

Y

Y

Y

3.136

340911

340932

Plus

276-2

-

-

UAGGAACUUCAUACCGUGCUCU

22

Y

Y

Y

3.136

541192

541213

Plus

276-3

-

-

UAGGAACUUCAUACCGUGCUCU

22

Y

Y

Y

3.2457

930

951

Plus

210.1

720

5

UUGUGCGUGUGACAACGGCUAU

22

Y

Y

Y

3.549

157657

157678

Minus

927

703

21

CAAAGCGUUUGGAUUCUGAAAC

22

Y

Y

Y

3.11

560282

560302

Plus

bantam-3p

689

-

UGAGAUCAUUUUGAAAGCUGA

21

Y

Y

Y

3.65

199698

199718

Minus

8-5p

594

-

CAUCUUACCGGGCAGCAUUAGA

22

Y

Y

Y

3.40

815904

815925

Minus

2

547

2

UAUCACAGCCAGCUUUGAAGAGC

23

Y

Y

Y

3.366

116861

116883

Minus

998

434

0

UAGCACCAUGAGAUUCAGC

19

?

?

Y

3.153

639527

639545

Minus

210.2

405

-

CUUGUGCGUGUGACAACGGCUAU

23

Y

Y

Y

3.549

157657

157679

Minus

14

358

0

UCAGUCUUUUUCUCUCUCCUAU

22

Y

Y

Y

3.676

52251

52272

Minus

285

324

5

UAGCACCAUUCGAAAUCAGUAC

22

?

?

Y

3.98

262290

262311

Minus

1890

287

0

UGAAAUCUUUGAUUAGGUCUGG

22

Y

?

?

3.64

982786

982807

Minus

190-1

231

0

AGAUAUGUUUGAUAUUCUUGGUUG

24

Y

Y

Y

3.181

347953

347976

Minus

190-2

-

-

AGAUAUGUUUGAUAUUCUUGGUUG

24

Y

Y

Y

3.351

105098

105121

Minus

283

224

0

CAAUAUCAGCUGGUAAUUCUGGG

23

Y

Y

Y

3.57

559462

559484

Plus

7

192

0

UGGAAGACUAGUGAUUUUGUUGU

23

Y

Y

Y

3.1

3357390

3357412

Minus

100

170

43

AACCCGUAGAUCCGAACUUGUG

22

Y

Y

Y

3.4

271414

271435

Plus

1891

167

1

UGAGGAGUUAAUUUGCGUGUUU

22

Y

?

?

3.829

180383

180404

Minus

999

165

0

UGUUAACUGUAAGACUGUGUCU

22

?

?

Y

3.14

96917

96938

Plus

309

33

1

UCACUGGGCAUAGUUUGUCGCAU

23

Y

?

Y

3.145

66041

66063

Minus

375

144

0

UUUGUUCGUUUGGCUCGAGUUAC

23

Y

Y

Y

3.455

42584

42605

Plus

306

143

65

UCAGGUACUGAGUGACUCUCAG

22

Y

?

Y

3.83

80436

80457

Plus

125

140

7

UCCCUGAGACCCUAACUUGUGA

22

Y

Y

Y

3.4

280975

280996

Plus

315

131

0

UUUUGAUUGUUGCUCAGAAAGC

22

Y

Y

Y

3.438

61926

61947

Plus

124

105

0

UAAGGCACGCGGUGAAUGC

19

Y

Y

Y

3.8

2074772

2074790

Plus

92b

96

0

AAUUGCACUUGUCCCGGCCUG

21

Y

Y

Y

3.722

164913

164933

Minus

1889-5p

89

-

UAAUCUCAAAUUGUAACAGUGG

22

Y

?

?

3.57

562555

562576

Plus

981-1

82

0

UUCGUUGUCGACGAAACCUGCA

22

Y

Y

Y

3.431

144482

144503

Plus

981-2

-

-

UUCGUUGUCGACGAAACCUGCA

22

Y

Y

Y

3.431

151371

151392

Plus

12

80

2

UGAGUAUUACAUCAGGUACUGGU

23

Y

Y

Y

3.57

563009

563031

Plus

31

76

2

UGGCAAGAUGUUGGCAUAGCUGA

23

?

Y

Y

3.559

256577

256599

Minus

10

59

40

CAAAUUCGGUUCUAGAGAGGUUU

23

Y

Y

Y

3.12

96000

96022

Minus

1174

58

0

CUGGGUAUUUUAGAUCAUCGGC

22

Y

?

?

3.86

865901

865922

Plus

**2945

52

0

UGACUAGAGGCAGACUCGUUU

20

Y

?

?

3.4

184461

184481

Plus

1000

49

0

AUAUUGUCCUGUCACAGCAGU

21

Y

Y

Y

3.153

102853

102873

Minus

13

37

3

UAUCACAGCCAUUUUGACGAGU

22

Y

Y

Y

3.366

116994

117015

Minus

996

36

2

UGACUAGAUUACAUGCUCGU

20

Y

Y

Y

3.19

1437010

1437029

Minus

137

33

0

UAUUGCUUGAGAAUACACGUAG

22

Y

Y

Y

3.1714

27566

27587

Minus

133

32

0

UUGGUCCCCUUCAACCAGCUGU

22

Y

Y

Y

3.1189

55748

55769

Plus

1175

35

7

AAGUGGAGUAGUGGUCUCAUCG

22

Y

?

?

3.86

866116

866137

Plus

279

26

21

UGACUAGAUCCACACUCAUUAA

22

Y

Y

Y

3.19

1441123

1441144

Minus

92a

24

-

UAUUGCACUUGUCCCGGCCUAU

22

Y

Y

Y

3.722

174912

174933

Minus

932-3p

22

-

UGCAAGCAAUGUGGAAGUGA

22

?

Y

Y

3.261

301413

301432

Minus

970

20

0

UCAUAAGACACACGCGGCUAU

21

Y

?

Y

3.495

35970

35990

Plus

316

18

0

UGUCUUUUUCCGCUUACUGCCG

22

?

Y

Y

3.496

152508

152529

Minus

305

17

1

AUUGUACUUCAUCAGGUGCUCU

22

Y

Y

Y

3.291

339134

339155

Plus

**2944a-1

13

1

GAAGGAACUUCUGCUGUGAUC

21

Y

?

?

3.66

328681

328701

Minus

**2944a-2

-

-

GAAGGAACUUCUGCUGUGAUC

21

Y

?

?

3.145

66240

66260

Minus

988

11

5

CCCUUGUUGCAAACCUCACGC

21

Y

?

Y

3.791

14331

14351

Plus

932-5p

11

-

UCAAUUCCGUAGUGCAUUGCAG

22

?

Y

Y

3.261

301450

301471

Minus

1889-3p

7

-

CACGUUACAGAUUGGGGUUUCC

22

Y

?

?

3.57

562642

562663

Plus

993

4

1

UACCCUGUAGUUCCGGGCUUUU

22

Y

Y

Y

3.12

55487

55508

Plus

278

3

0

UCGGUGGGACUUUCGUCCGUUU

22

Y

Y

Y

3.16

1026212

1026233

Plus

965

2

0

UAAGCGUAUAGCUUUUCCCAUU

22

Y

?

Y

3.48

484177

484198

Plus

Iab-4

2

1

ACGUAUACUGAAUGUAUCCUGA

22

Y

Y

Y

3.12

681163

681184

Plus

980

2

0

UAGCUGCCUAGUGAAGGGC

19

?

?

Y

3.263

352922

352940

Plus

308

3

1

CGCAGUAUAUUCUUGUGGCUUG

22

Y

?

Y

3.98

764133

764154

Plus

79

2

0

GCUUUGGCGCUUUAGCUGUAUGA

23

Y

Y

Y

3.83

80591

80613

Plus

**2943

1

0

UAAGUAGGCACUUGCAGGCAAAG

23

Y

?

?

3.121

94164

94186

Minus

**2944b-1

1

0

GAAGGAACUCCCGGUGUGAUAU

22

Y

?

?

3.66

328838

328859

Minus

**2944b-2

-

-

GAAGGAACUCCCGGUGUGAUAU

22

Y

?

?

3.145

66389

66410

Minus

33

predicted

GUGCAUUGUAGUUGCAUUGCA

21

?

Y

Y

3.1258

69381

69401

Minus

2951

162309

342

AAGAGCUCAGCACGCAGGGGUGGC

24

?

?

?

multiple

2952

2203

-

UAGUACGGCCAUGACUGAGGGC

22

?

?

?

3.5

753922

753943

Minus

2941-1

1221

3

UAGUACGGCUAGAACUCCACGG

22

?

?

?

3.5

753643

753664

Minus

2941-2

-

1

UAGUACGGCUAGAACUCCACGG

22

?

?

?

3.5

753797

753818

Minus


aga = An. gambiae; ame = Ap. mellifera; dme = D. melanogaster.

Top group: miRNAs and miRNA* strands identified by deep sequencing

Middle group: predicted miR-33 was identified in C7/10 cells but absent from Cx. quinquefasciatus. miR-33 was cross-referenced with the Cx. quinquefasciatus genome.

Bottom group: novel miRNAs identified in this study.

** novel miRNAs (not present in miRBase v14) recently identified in Ae. aegypti mosquitoes while this manuscript was under review

Skalsky et al. BMC Genomics 2010 11:119   doi:10.1186/1471-2164-11-119

Open Data