Table 3

Novel predicted miRNA loci.

Sequence

Location

Count

Hairpin length

Predicted Targets


TCTTTCCGAGTCCTCCCATACC

scaffold_155:237816..237837

147

171

Yes

TCGTAATGCTTCATTCTCACAA1a

scaffold_148:201299..201320

49

90

Yes

TCGAATTTGGGCTTGAGATTGa

LG_III:7559439..7559459

107

101

Yes

TTGTAAGGGAAGCCCACATGG3a

LG_I:1810419..1810439

971

119

Yes

TCTTGCTCAAATGAGTATTCCA1

LG_XV:698203..698224 (miR828)

55

148

Yes

TTCATTCCTCTTCCTAAAATGG1, 3

LG_XII:8278996..8279017

647

142

Yes

TCTTGCTCAAATGAGTATTCCA

LG_XII:2137739..2137760 (miR828)

55

146

Yes

CATCTGCAGACTACTTGCCTTa

LG_XIV:3657623..3657643

5

108

Yes

TTCATTCCTCTTCCTAAAATGG3

scaffold_129:380652..380673

647

128

Yes

TCATGAATTCAACCTGATTGGa

LG_II:14180794..14180814

106

255

No

AGCTCCGAGCTCTAATTATGTGGG2

LG_II:22547443..22547466

20

174

No

TTCCTACAGTTATGATGGCCC3a

LG_VI:6175922..6175942

18

115

No

TCTGTCGCTGGAAAGATGGTACa

LG_XVII:3400803..3400824

77

147

No

GGCATGAGGTGTTTGGCAAGA1a

LG_II:21846112..21846132

13

126

No

ATATGATGGGTCTCATTTAGTAGA

LG_XIV:2363320..2363343

32

240

No


Novel predicted miRNA loci with an identified miRNA* sequence and a minimum miRNA read count of 5, as identified using the UEA Plant sRNA toolkit miRCat tool. 1Overlaps an aligned EST. 2Overlaps a repeat. 3Predicted in [56]. aShows no homology to existing plant miRNAs.

Klevebring et al. BMC Genomics 2009 10:620   doi:10.1186/1471-2164-10-620

Open Data