Table 4

Primers and probes used for molecular biomarkers: Primer pairs and TaqMan probes used in q-PCR assessments.

Accession no.

Gene

Primer Sequences

Probe No.


FJ711577

Aspartoacylase

Left:

ggaggcacacatgggaatg

109

Right:

cttcctctgaatctctgttccattatc

FJ711576

Parvalbumin

Left:

gaccaagacaagagtggcttca

101

Right:

tctggcaccagcagagaagtt

FJ711580

β-2 microglobulin

Left:

tctttcgcggtcatctttctc

22

Right:

ggttgtggccatacacctgaa

FJ711579

Hemopexin

Left:

catgcactacgaggacgacaag

143

Right:

tggtagtagctgaacaccttgctg

FJ711578

Caspase-3

Left:

gagaaccggtatgaaccaacg

159

Right:

tccaagcttcccaaacactttc

FJ711575

Titin a

Left:

tgatcactggcgtgaaagagg

159

Right:

caagctcattggacagtttgagg

FJ711581

ZPA

Left:

catgcggctgagtttggataa

106

Right:

tgccattgatagcatcaacttca

FJ711583

Myozenin*

Left:

ccaatgtcgtgctggtacacc

106

Right:

ctgccagacattgatgtagcca

FJ711584

Creatine kinase*

Left:

cgatcggcgttggagatg

163

Right:

gccaagttcaacgagattctgg

FJ711582

PXR

Left:

tgaggcggtggagaagag

144

Right:

gaggcggtggagaagag


* indicates biomarkers obtained from preliminary studies carried out during microarray development.

Connon et al. BMC Genomics 2009 10:608   doi:10.1186/1471-2164-10-608

Open Data