Table 2

RT-PCR primers

Primer name

Forward primer

Reverse primer


Hexamerin

aggagcaacctctcgcagaaag

tgacgggaagacttcaggaag

Calponin

ccagactattgatttgtgggaga

cgttcttgtcagcctctttgg

Arylphorin subunit

aacaagattgagcgcaagtcc

ctaggcatgttgtcgggcac

60 S acidic ribosomal protein P0

caaggaggctaccaccatca

cccatgtcgtcgtcgctct

Aldehyde dehydrogenase

cgccctggtcaaggaagc

ggagccggtgaaagcaact

Eukaryotic translation initiation factor 4A

ctggcatcaggtcgtggaaa

tgcaaggcataatagcgcgt

ATP synthase beta subunit

gcccgtggtgtccagaag

gggcacgagccacagtcag

Proteasome 3 alpha subunit

tctgcgagggaaggatggt

catcggaaatgagacctgctact

Broad

atggctgatcaattctgttta

gttcggtgaagagaaattttc

β-actin

cctggtattgctgacggtatgc

ctgttggatggtggagagggaa


Fu et al. BMC Genomics 2009 10:600   doi:10.1186/1471-2164-10-600

Open Data