Table 1

Sequence, location, and expression of miRNAs in Aedes aegypti.

Name1, 2

mirBase Name

Sequence3

Contig4

Start4

End4

Strand

Embryo5

Gut_SF5

Gut_BF5


aae-miR-M1-1

aae-miR-2943-1

TTAAGTAGGCACTTGCAGGCAAA

CONTIG_15246

25749

25829

+

28

0

0

aae-miR-M1-2

aae-miR-2943-2

TTAAGTAGGCACTTGCAGGCAAA

CONTIG_15246

25911

25981

+

28

0

0

aae-miR-M2

aae-miR-2942

TATTCGAGACTTCACGAGTTAAT

CONTIG_11944

151669

151750

+

0

0

7

aae-miR-M3

aae-miR-2945

TGACTAGAGGCAGACTCGTTTA

CONTIG_2929

123975

124056

+

33

0

6

aae-miR-M3*

aae-miR-2945*

AGCGGGTCCGTTTCTAGTGTCATG

CONTIG_2929

123975

124056

+

3

0

0

aae-miR-M4a

aae-miR-2944a

GAAGGAACTTCTGCTGTGATCTGA

CONTIG_18252

93868

93929

+

91

2

0

aae-miR-M4a*

aae-miR-2944a*

TATCACAGTAGTTGTACTTTAA

CONTIG_18252

93868

93929

+

3

0

0

aae-miR-M4b

aae-miR-2944b

GAAGGAACTCCCGGTGTGATATA

CONTIG_18252

93731

93792

+

62

0

0

aae-miR-M4b*

aae-miR-2944b*

TATCACAGCAGTAGTTACCTGA

CONTIG_18252

93731

93792

+

24

0

0

aae-miR-N1-1

aae-miR-2941-2

TAGTACGGCTAGAACTCCACGGA

CONTIG_16241

318005

318105

-

288

1

1

aae-miR-N1-2

aae-miR-2941-1

TAGTACGGCTAGAACTCCACGGA

CONTIG_16241

317700

317799

-

288

1

1

aae-miR-N2

aae-miR-2946

TAGTACGGAAAAGATATGGGGA

CONTIG_16241

318135

318222

-

5

0

0

aae-miR-1174

aae-miR-1174

TCAGATCTACTTAATACCCAT

CONTIG_7232

17531

17665

+

aae-miR-1175

aae-miR-1175

TGAGATTCTACTTCTCCGACTTAA

CONTIG_7232

17737

17816

+

0

0

1

aae-miR-1175*

aae-miR-1175*

TAAGTGGAGTAGTGGTCTCATCGCT

CONTIG_7232

17737

17816

+

0

2

59

aae-miR-1890

aae-miR-1890

TGAAATCTTTGATTAGGTCTGG

CONTIG_10435

60786

60931

+

1

0

0

aae-miR-1891-1

aae-miR-1891-1

TGAGGAGTTAATTTGCGTGTTT

CONTIG_10244

3984

4069

-

2

0

0

aae-miR-1891-2

aae-miR-1891-2

TGAGGAGTTAATTTGCGTGTTT

CONTIG_18287

4656

4741

+

2

0

0

aae-miR-1889

aae-miR-1889

CACGTTACAGATTGGGGTTTCC

CONTIG_4323

23786

23921

-

0

0

3

aae-bantam

aae-bantam

TGAGATCATTTTGAAAGCTGATT

CONTIG_3301

208288

208426

-

1

2

2

aae-let-7

aae-let-7

TGAGGTAGTTGGTTGTATAGT

CONTIG_2929

321614

321684

+

0

0

5

aae-miR-1

aae-miR-1

TGGAATGTAAAGAAGTATGGAG

CONTIG_25061

66256

66338

+

1

0

1

aae-miR-10

aae-miR-10

ACCCTGTAGATCCGAATTTGTT

CONTIG_17639

8749

8833

+

1

0

0

aae-miR-100

aae-miR-100

AACCCGTAGATCCGAACTTGTG

CONTIG_2929

307441

307568

+

aae-miR-1000-1

aae-miR-1000-1

ATATTGTCCTGTCACAGCAGT

CONTIG_35246

172

265

-

aae-miR-1000-2

aae-miR-1000-2

ATATTGTCCTGTCACAGCAGT

CONTIG_9774

12985

13078

+

aae-miR-11

aae-miR-11

CATCACAGTCTGAGTTCTTGCTT

CONTIG_23911

46399

46488

+

1861

42

436

aae-miR-11*

aae-miR-11*

CGAGAACTCCGGCTGTGACCTGTG

CONTIG_23911

46399

46488

+

4

0

2

aae-miR-12

aae-miR-12

TGAGTATTACATCAGGTACTGGT

CONTIG_4323

23386

23503

-

aae-miR-124

aae-miR-124

TAAGGCACGCGGTGAATGCCAAG

CONTIG_531

21343

21423

-

3

0

0

aae-miR-125

aae-miR-125

TCCCTGAGACCCTAACTTGTGAC

CONTIG_2929

321885

321975

+

0

0

3

aae-miR-133

aae-miR-133

TTGGTCCCCTTCAACCAGCTGT

CONTIG_24522

50243

50347

-

aae-miR-137-1

aae-miR-137-1

TTATTGCTTGAGAATACACGTA

CONTIG_7773

15414

15486

-

aae-miR-137-2

aae-miR-137-2

TTATTGCTTGAGAATACACGTA

CONTIG_29705

92457

92529

+

aae-miR-13b

aae-miR-13

TATCACAGCCATTTTGACGAGTT

CONTIG_12793

17619

17710

-

168

2

42

aae-miR-14

aae-miR-14

TCAGTCTTTTTCTCTCTCCTAT

CONTIG_12112

693

785

-

1

1

6

aae-miR-184

aae-miR-184

TGGACGGAGAACTGATAAGGGC

CONTIG_19030

3452

3535

-

957

76

1307

aae-miR-190

aae-miR-190

AGATATGTTTGATATTCTTGGTTG

CONTIG_10108

2092

2180

-

83

2

43

aae-miR-193

aae-miR-193

TACTGGCCTACTAAGTCCCAAC

CONTIG_19568

51035

51158

+

aae-miR-2a

aae-miR-2a

TATCACAGCCAGCTTTGATGAGCT

CONTIG_12793

16130

16216

-

1217

80

249

aae-miR-210

aae-miR-210

TTGTGCGTGTGACAACGGCTAT

CONTIG_19443

85221

85292

-

3

12

12

aae-miR-219

aae-miR-219

TGATTGTCCAAACGCAATTCTTG

CONTIG_15776

56993

57078

+

aae-miR-2b

aae-miR-2b

TATCACAGCCAGCTTTGAAGAGCG

CONTIG_12793

17471

17562

-

758

74

147

aae-miR-2c

aae-miR-2c

TATCACAGCCAGCTTTGATGAGC

CONTIG_12793

17971

18048

-

1218

80

249

aae-miR-252

aae-miR-252

CTAAGTACTAGTGCCGCAGGAGA

CONTIG_3685

79002

79177

-

38

0

1

aae-miR-252*

aae-miR-252*

CCTGCTGCCCAAGTGCTTATCGAA

CONTIG_3685

79002

79177

-

5

0

0

aae-miR-263

aae-miR-263a

AATGGCACTGGAAGAATTCACGGG

CONTIG_27430

4746

4821

-

53

1

1

aae-miR-263*

aae-miR-263a*

CGTGTTCTGGCAGTGGCATCCC

CONTIG_27430

4746

4821

-

6

0

0

aae-miR-263b

aae-miR-263b

CTTGGCACTGGGAGAATTCACAG

CONTIG_1908

33267

33357

+

6

0

0

aae-miR-263b*

aae-miR-263b*

TGGATCTTTTCGTGCCATCGT

CONTIG_1908

33267

33357

+

1

0

0

aae-miR-275

aae-miR-275

TCAGGTACCTGAAGTAGCGCGCG

CONTIG_1651

96625

96720

+

0

0

5

aae-miR-275*

aae-miR-275*

CGCGCTAAGCAGGAACCGAGACT

CONTIG_1651

96625

96720

+

1

0

6

aae-miR-276-1

aae-miR-276-1

TAGGAACTTCATACCGTGCTCT

CONTIG_417

10988

11177

-

aae-miR-276-2

aae-miR-276-2

TAGGAACTTCATACCGTGCTCT

CONTIG_7617

38953

39087

+

aae-miR-277

aae-miR-277

TAAATGCACTATCTGGTACGACA

CONTIG_12646

3556

3644

+

aae-miR-278

aae-miR-278

TCGGTGGGACTTTCGTCCGTTT

CONTIG_1172

33037

33128

+

6

0

2

aae-miR-279

aae-miR-279

TGACTAGATCCACACTCATTAA

CONTIG_17556

116934

117006

-

26

0

2

aae-miR-281

aae-miR-281

CTGTCATGGAATTGCTCTCTTTA

CONTIG_27100

34036

34204

+

1

16

50

aae-miR-281*

aae-miR-281*

AAAGAGAGCTATCCGTCGACAGTA

CONTIG_27100

34036

34204

+

164

5686

4806

aae-miR-282-1

aae-miR-282-1

AATCTAGCCTCTCCTAGGCTTTGTCTG

CONTIG_15805

19414

19548

+

aae-miR-282-1*

aae-miR-282-1*

ACATAGCCTGACAGAGGTTAGG

CONTIG_15805

19414

19548

+

2

0

0

aae-miR-282-2

aae-miR-282-2

AATCTAGCCTCTCCTAGGCTTTGTCTG

CONTIG_15982

5479

5613

-

aae-miR-282-2*

aae-miR-282-2*

ACATAGCCTGACAGAGGTTAGG

CONTIG_15982

5479

5613

-

2

0

0

aae-miR-283

aae-miR-283

CAATATCAGCTGGTAATTCTGGG

CONTIG_4323

32334

32426

-

6

1

131

aae-miR-285

aae-miR-285

TAGCACCATTCGAAATCAGT

CONTIG_1634

212427

212492

-

0

1

0

aae-miR-286a-1

aae-miR-286b-1

TGACTAGACCGAACACTCGTATCC

CONTIG_21241

18407

18503

+

8

0

0

aae-miR-286a-2

aae-miR-286b-2

TGACTAGACCGAACACTCGTATCC

CONTIG_8291

17656

17752

+

8

0

0

aae-miR-286b

aae-miR-286a

TGACTAGACCGAACACTCGCGTCCT

CONTIG_18252

93413

93509

+

10

0

0

aae-miR-305

aae-miR-305

ATTGTACTTCATCAGGTGCTCTGG

CONTIG_1651

105677

105766

+

0

0

2

aae-miR-305*

aae-miR-305*

CGGCACATGTTGGAGTACACTTAA

CONTIG_1651

105677

105766

+

0

0

7

aae-miR-306

aae-miR-306

TCAGGTACTGAGTGACTCTCAG

CONTIG_24640

55004

55128

+

119

0

27

aae-miR-307

aae-miR-307

TCACAACCTCCTTGAGTGAGCGA

CONTIG_1157

147943

148043

-

1

0

0

aae-miR-308

aae-miR-308

AATCACAGGAGTATACTGTGAG

CONTIG_6324

6462

6528

+

aae-miR-308*

aae-miR-308*

CGCGGTATATTCTTGTGGCTTGA

CONTIG_6324

6462

6528

+

2

0

0

aae-miR-31

aae-miR-31

TGGCAAGATGTTGGCATAGCTGAAA

CONTIG_21960

98153

98301

-

1

0

3

aae-miR-315

aae-miR-315

TTTTGATTGTTGCTCAGAAAGCC

CONTIG_21501

12498

12562

+

27

1

0

aae-miR-315*

aae-miR-315*

CTTTCGAGCAGTAATCAAAGTc

CONTIG_21501

12498

12562

+

5

0

0

aae-miR-316

aae-miR-316

TGTCTTTTTCCGCTTACTGCCG

CONTIG_13460

10738

10828

-

0

0

1

aae-miR-317-1

aae-miR-317-1

TGAACACAGCTGGTGGTATCTCAGT

CONTIG_12640

88437

88524

+

36

38

737

aae-miR-317-2

aae-miR-317-2

TGAACACAGCTGGTGGTATCTCAGT

CONTIG_8451

9550

9637

-

36

38

737

aae-miR-3a-1

aae-miR-309a-1

TCACTGGGCAAAGTTTGTCGCA

CONTIG_21241

18967

19043

+

6

0

0

aae-miR-3a-2

aae-miR-309a-2

TCACTGGGCAAAGTTTGTCGCA

CONTIG_8291

18216

18292

+

6

0

0

aae-miR-3b

aaw-miR-309b

TCACTGGGCATAGTTTGTCGCA

CONTIG_18252

94047

94117

+

3

0

0

aae-miR-3b*

aae-miR-309b*

CGTCAAACTCCGTTCAGTTGGTG

CONTIG_18252

94047

94117

+

1

0

0

aae-miR-33

aae-miR-33

GTGCATTGTAGTTGCATTGCA

CONTIG_18815

108787

108866

+

aae-miR-34

aae-miR-34

TGGCAGTGTGGTTAGCTGGTTGTG

CONTIG_12646

4278

4400

+

44

55

639

aae-miR-375

aae-miR-375

TTTGTTCGTTTGGCTCGAGTTA

CONTIG_14081

238834

238944

-

1

0

0

aae-miR-7

aae-miR-7

TGGAAGACTAGTGATTTTGTTGTT

CONTIG_31115

46028

46112

+

14

0

0

aae-miR-71

aae-miR-71

AGAAAGACATGGGTAGTGAGATA

CONTIG_12793

18215

18396

-

39

2

7

aae-miR-71*

aae-miR-71*

TCTCACTACCTTGTCTTTCATG

CONTIG_12793

18215

18396

-

6

0

0

aae-miR-79

aae-miR-79

ATAAAGCTAGATTACCAAAGCAT

CONTIG_24640

55215

55284

+

2

0

0

aae-miR-8

aae-miR-8

TAATACTGTCAGGTAAAGATGTC

CONTIG_16942

34594

34660

+

32

1

38

aae-miR-8*

aae-miR-8*

CATCTTACCGGGCAGCATTAGA

CONTIG_16942

34594

34660

+

7

2

4

aae-miR-87

aae-miR-87

GGTGAGCAAATTTTCAGGTGT

CONTIG_15587

30157

30251

+

aae-miR-927

aae-miR-927

TTTAGAATTCCTACGCTTTACC

CONTIG_1795

170460

170534

+

aae-miR-929-1

aae-miR-929-1

ATTGACTCTAGTAGGGAGTCC

CONTIG_12461

76647

76734

-

aae-miR-929-2

aae-miR-929-2

ATTGACTCTAGTAGGGAGTCC

CONTIG_34315

3294

3381

+

aae-miR-92a

aae-miR-92a

TATTGCACTTGTCCCGGCCTAT

CONTIG_6821

67755

67832

+

74

0

5

aae-miR-92a*

aae-miR-92a*

CGGTACGGACAGGGGCAACATT

CONTIG_6821

67755

67832

+

6

0

0

aae-miR-92b

aae-miR-92b

AATTGCACTTGTCCCGGCCTGC

CONTIG_6824

4049

4131

+

74

0

5

aae-miR-92b*

aae-miR-92b*

AGGTCGTGACTTGTGCCCGTTTG

CONTIG_6824

4049

4131

+

12

0

0

aae-miR-932

aae-miR-932

TCAATTCCGTAGTGCATTGCAG

CONTIG_28378

72232

72319

-

aae-miR-957

aae-miR-957

TGAAACCGTCCAAAACTGAGGC

CONTIG_591

147619

147787

+

aae-miR-965

aae-miR-965

TAAGCGTATAGCTTTTCCC

CONTIG_3410

87378

87524

+

aae-miR-970

aae-miR-970

TCATAAGACACACGCGGCTAT

CONTIG_11324

29252

29338

+

1

0

3

aae-miR-981

aae-miR-981

TTCGTTGTCGACGAAACCTGCA

CONTIG_7302

184768

184853

-

aae-miR-988

aae-miR-988

CCCCTTGTTGCAAACCTCACGC

CONTIG_17684

77966

78086

-

3

0

1

aae-miR-988*

aae-miR-988*

GTGTGCTTTGTGACAATGAGA

CONTIG_17684

77966

78086

-

2

0

2

aae-miR-989

aae-miR-989

TGTGATGTGACGTAGTGGTAC

CONTIG_6774

51048

51137

-

2

33

3

aae-miR-993

aae-miR-993

GAAGCTCGTTTCTATAGAGGTATCT

CONTIG_28305

82579

82660

+

aae-miR-996

aae-miR-996

TGACTAGATTACATGCTCGTCT

CONTIG_17556

112174

112267

-

aae-miR-998

aae-miR-998

TAGCACCATGAGATTCAGCTC

CONTIG_23911

46676

46764

+

164

6

42

aae-miR-999

aae-miR-999

TGTTAACTGTAAGACTGTGTCT

CONTIG_6027

163128

163269

+

aae-miR-9a-1

aae-miR-9a-1

TCTTTGGTTATCTAGCTGTATGA

CONTIG_19539

116871

116951

+

16

1

2

aae-miR-9a-2

aae-miR-9a-2

TCTTTGGTTATCTAGCTGTATGA

CONTIG_19541

4061

4141

+

16

1

2

aae-miR-9b

aae-miR-9b

TCTTTGGTGATTTTAGCTGTATGC

CONTIG_24640

55513

55604

+

134

0

69

aae-miR-9c

aae-miR-9c

TCTAAAGCTTTAGTACCAGAGGTC

CONTIG_24640

28160

28257

+

5

0

0

aae-miR-iab-4-1

aae-miR-iab-4-1

CGGTATACCTTCAGTATACGTAAC

CONTIG_17255

44653

44726

-

aae-miR-iab-4-2

aae-miR-iab-4-2

CGGTATACCTTCAGTATACGTAAC

CONTIG_23219

23581

23654

+


Notes:

1. The first block (miR-M1-1 through miR-N2) are novel miRNAs that are discovered in this study. We have not detected homology to any known miRNAs or genomic sequences outside of mosquito species. The second block (miR-1174 through miR-1889) contains miRNAs that are homologous to previously reported "mosquito-specific" miRNAs. The third block, comprised of the remaining miRNAs, contains miRNAs that have homologues outside of mosquitoes.

2. Naming in this column is temporary. Mirbase assigned names are shown in column 2, which was received after the acceptance of the manuscript. "-1", and "-2" suffixes refer to different hairpins that produce the same mature miRNA. "a", and "b" suffixes refer to different hairpins that produce similar but not identical miRNAs.

3. Underlined sequences are cases where there are extra bases at the 5' or 3' ends and they are the majority in at least six small RNA sequences. Italicized sequences are cases where such sequences are detected but they are either not the majority or there are less than six 454 sequence hits. As poly-As are added to the small RNAs, adenine(s) at the 3' end cannot be confirmed by this sequencing approach.

4. The contig, start, and end positions refer to the locations of the pre-miRNA hairpins.

5. The last three columns are the number of sequence hits in small RNA libraries obtained by 454 sequencing. The total small RNA reads are 55, 000, 33, 000, and 42, 000 in embryos, sugar-fed midguts (Gut_SF), and blood-fed midguts (Gut_BF), respectively. The total number of hits for all Ae. aegypti miRNAs are 8369, 6260, and 9922 in embryos, sugar-fed midguts (Gut_SF), and blood-fed midguts (Gut_BF), respectively. There are a few cases where we did not distinguish the hits from nearly identical miRNAs.

Li et al. BMC Genomics 2009 10:581   doi:10.1186/1471-2164-10-581

Open Data