Table 2

Oligonucleotides used for Northern blotting

Name

Sequence 5'->3'

Position


Alu

GCGATCTCGGCTCACTGCAAG

238-218

5SrRNA

AAAGCCTACAGCACCCGGTATT

120-99

ATAD3B-sen

GGATTCCGTGCCTTTGTGA

807-825

ATAD3B-anti

TTGGTGTTCCTGGTTGCTA

1099-1117

AluJb-641

AAAATGCTGGGATTACAGGCCT

AluJo-576611

TGCCCAGGCTGGAGTGCAGT

AluJo-135090

CACTGCAACCTCCACCTCCTGG

Let-7a

AACTATACAACCTACTACCTCA


Gu et al. BMC Genomics 2009 10:563   doi:10.1186/1471-2164-10-563

Open Data