Table 2

Read frequency and mature sequences of Gossypium hirsutum novel miRNA candidates.

ID

Precursor

Library

5p Reads

3p Reads

5p Sequence (5' -- 3')

3p Sequence (5' -- 3')


miRNVL1

AI054573

WT

324

5

ACTTTTGAACTGGATTTGCCGA(22)

M

750

4

TGCAAATCCAGTCAAAAGTTA(21)

miRNVL2

DW497660

WT

79

3

TGAACTGGGTTTGTTGGCTGC(21)

M

234

0

AGCCAACAACATCAGTTCTAA(21)


The 5p and 3p sequences originate from the 5' and 3' arm of the folded precursors, respectively. WT: Xuzhou 142 (wild-type); M: fuzzless-lintless mutant in Xuzhou 142 background.

Kwak et al. BMC Genomics 2009 10:457   doi:10.1186/1471-2164-10-457

Open Data