Table 9

Primer sequences for qPCR analysis of Cse4, PolII and Ste12 ChIPs

qPCR experiment

Pair name

Primer name

Sequence


Cse4

Cse4P1

Cse4P1for

GATCAGCGCCAAACAATATGGAAAATCC

Cse4

Cse4P1

Cse4P1rev

AACTTCCACCAGTAAACGTTTCATATATCC

Cse4

Cse4P2

Cse4P2for

CGTATTACAATGGCCGAAGGC

Cse4

Cse4P2

Cse4P2rev

GCGACAACAAGAGGGAAATGA

Cse4

Cse4P3

Cse4P3for

CGTCCAAACATGAAAGTGCTCC

Cse4

Cse4P3

Cse4P3rev

CAGCGATTGACTTTCTCCCATT

Cse4

Cse4P4

Cse4P4for

GAAGCGTTATGGAACCTGTCGAA

Cse4

Cse4P4

Cse4P4rev

GTCGGTCGTCCAATATCATCGTAAA


PolII

Pol2P1

Pol2P1for

ACCGGTACAAGGACAAGACG

PolII

Pol2P1

Pol2P1rev

GTTCGTTCTCACGCACTTCA

PolII

Pol2P2

Pol2P2for

AAGACGCTCGAAACCAAGTG

PolII

Pol2P2

Pol2P2rev

GCTCACGTTTTGCAATGATG

PolII

Pol2P3

Pol2P3for

GACCGTTGCAAGGATTGATAA

PolII

Pol2P3

Pol2P3rev

TCAACCGAAGGAAGGAGAAA

PolII

Pol2P4

Pol2P4for

ATTGCCTGGTTCTTGTCCTG

PolII

Pol2P4

Pol2P4rev

CGTTGGCATATCACACCTTG


Ste12

Ste12P1

Pseudo35

CCCGTAGTCCGGTTTAATCA

Ste12

Ste12P1

Pseudo36

AACTGTGCATGAGCCAAGAG

Ste12

Ste12P2

Pseudo37

AAAAGGAGATAGGGCCCAGA

Ste12

Ste12P2

Pseudo38

CCAGAACAGCCAGCTAGACC

Ste12

Ste12P3

Pseudo39

TCGGGCTTCTAAGGCAAATA

Ste12

Ste12P3

Pseudo40

TCCTTTAAATGATGTTGCGATG

Ste12

Ste12P4

Pseudo41

TGTAGCCCAACGGATTCTTC

Ste12

Ste12P4

Pseudo42

AGAAGCTTTGCCAGGTGAAA


Lefran├žois et al. BMC Genomics 2009 10:37   doi:10.1186/1471-2164-10-37

Open Data