Table 1

Oligonucleotide sequences for generation of the four barcoded adapters

Oligo name

Barcode

Modification

Sequence (5'→3')


MPLEXA1F

GTAT

None

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAT

MPLEXA1R

GTAT

5' phosphate

TACAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG

MPLEXA6F

CATT

None

ACACTCTTTCCCTACACGACGCTCTTCCGATCTCATT

MPLEXA6R

CATT

5' phosphate

ATGAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG

MPLEXA8F

ACGT

None

ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGT

MPLEXA8R

ACGT

5' phosphate

CGTAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG

MPLEXA9F

TGCT

None

ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCT

MPLEXA9R

TGCT

5' phosphate

GCAAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG


Lefrançois et al. BMC Genomics 2009 10:37   doi:10.1186/1471-2164-10-37

Open Data