Table 2

Primer pairs and corresponding annealing temperatures used for successful amplification of mitochondrial genome fragments from Sipunculus nudus

Primer names

Primer sequence (5'-3')

Annealing temperature

Approxim. size of PCR product


Sn-cox1-f

CTCCCACTTAGCACCCTC

48°C

400 bp

Sn-cox2-r

TAAGAGAATAATGGCGGG

Sn-cox2-f

CCAACCACTCTTTTATGCC

50°C

700 bp

Sn-cox3-r

CCAGGATTAGGGCGGT

Sn-cox3-f

TTTTCCTATACCTCTGCATC

48°C

700 bp

Sn-cob-r

TTGAATGACAAGGCAGAGA

Sn-cob-f

CTCCTCGCCCCCAA

48°C

2500 bp

Sn-16S-r

GATTTATTGAAGAGTGGTTAGTGA

Sn-16S-f

TCATACCCCGCACTCC

48°C

600 bp

Sn-nd3-r

CAAACCCGCACTCAAAC

Sn-nd3-f

GGTAAGTGAACGGGGAAC

50°C

2500 bp

Sn-nd1-r

AAAAGGTTGGGGGAGG

Sn-nd1-f

CGCTATCACCTCCACCTT

50°C

4000 bp

Sn-cox1-r

ATTCGGCACGGATAAGA


Mwinyi et al. BMC Genomics 2009 10:27   doi:10.1186/1471-2164-10-27

Open Data