Table 4

Novel zebrafish miRNAs. miRNAs identified in this study, their level of conservation and corresponding miRNA families.

miRNA ID

miRNA sequence

Conservation

miRNA family

miRDeep prediction

Ensembl prediction


miR_1

AACAGTAAGAGTTTATGTGCTG

Non-conserved

-

No


miR _2

CGGTGCAGGACTCCGCGGCTC

Non-conserved

-

No


miR _3

AAGTGGCCTCTAAAAGTCTA

Non-conserved

-

No


miR _4

TAATACTGCCTGGTAATGCCAT

Conserved

miR-429


miR _5

ATCTCAGGTTCGTCAGCCCATG

Conserved

miR-1388


miR _6

GGCTTGTTTTAAGTTGCCTGCG

Conserved

miR-1788


miR _7

TTACAGGCTATGCTAATCTATG

Non-conserved

-

No


miR _8

AAGGTCCAACCTCACATGTCC

Non-conserved

-

No


miR _9

TGATTGTTTGTATCAGCTGTGT

Non-conserved

-

No


miR _10

TAGGGGTATGATTCTCGC

Non-conserved

-

No


miR _11

TAGGTAGTTTGATGTTGTTGGG

Conserved

miR-196


miR _12

CGGCCCGTCCGGTGCGCTCGGAT

Non-conserved

-

No


miR _13

TCACACCTACAATCCCTGGCA

Non-conserved

-

No


miR _14

AAAGTGAAAGGTGACTGAGAC

Non-conserved

-

No


miR _15

TAGGTAGTTTTATGTTGTTGGG

Conserved

miR-196


miR _16

AGCAGCATTGTACAGGGCTTT

Conserved

miR-107


miR _17

GTATGTGCCCTTGGACTACATT

Conserved

miR-455

No


miR _18

TATGTGTGTATCAATTGTGTGAAA

Non-conserved

-

No


miR_19

GTAATGCTTCGACTGATTGGTG

Non-conserved

-

No


miR _20

AGATTGGGGTGAGTTAGGGTG

Non-conserved

-

No


miR _21

AGCTACATCTGAATACTGGGTCA

Conserved

miR-222


miR _22

CCTCTCTGTGCTGCCATTTGGGAC

Non-conserved

-

No


miR _23

ATGATTCGACTCATATGGTG

Non-conserved

-

No


miR _24

AGCTCGTGTCCCAAGGCGCCT

Non-conserved

-

No


miR_25

TCGTACCGTGAGTAATAGTGCA

Conserved

miR-126

No


The novel miRNAs were numbered sequentially from 1 to 25.

Soares et al. BMC Genomics 2009 10:195   doi:10.1186/1471-2164-10-195

Open Data