Table 2

Location of selected indel-markers (position on the respective chromosome in the dog genome assembly), primer sequences, amplicon length and expected heterozygosities from the genotyping of 18 wolves from worldwide.

No.

Chromosome

Position

Primer F

Primer R

Fragment length (bp)

He


1

23

35377868

ccaggcttgtgtgaagctct

gccttgttggtttcagtggt

126

0.43

2

21

44954960

tgtcatttggccagatctctaa

ttggattaaccctaccacacg

117

0.26

3

5

56432744

catgctgcttgaagtgcaata

tctctgtgtgcctctcatgaat

123

0.00

4

6

31824728

cacaatgaccacttattaaagattaca

ctaggatgagagcccagctt

139

0.00

5

29

17604384

tgtcaggtttcatatccttttgtg

gaactatccttaaatagaaccaatgc

111

0.29

6

15

52623379

ttcacatccatctgtcttgga

acccgggagtttgcctatac

125

0.20

7

12

4364137

ctcctgttccctccagca

ggaccatgctgtggatctg

115

0.17

8

30

32665884

agaccagggtctgaatttgc

tttccaaggtcccaccacta

116

0.24

9

7

52754426

ttcacaaattgctatacctaaaaatg

ttcctgtgggcataataatca

136

0.48

10

26

32666193

tccaagaacaaagaagtaatgtaaaa

ggaattgatttactgatagtgagatg

130

0.39

11

37

18098142

gaaaggtccctctgaattgaa

tctgtgctcttcactggaaaaa

122

0.18

12

14

38060282

gtgtgctctaggggccatt

gaatgaaatcatggaagagcaa

115

0.30

13

17

46184901

gaagggacaaaaccttggaa

tgaactaccctcgtgatcca

139

0.37

14

28

38785954

aaaggagggcttgcagtttt

ttctccttttagaccctttgtca

90

0.32

15

25

8846761

tgccttagcgttggcatt

tggtgctctttcttgttgga

169

0.36

16

34

7543229

caggagcaaagtaagggtaatca

gctttggtattgttgattctattgtaa

90

0.44

17

20

21505420

aatggggacaccagtcactt

tgggagttctggctccac

139

0.00

18

1

32746664

tcctgcggcagtttgg

ccaagattgtgcatgtcagg

104

0.36

19

23

42171234

caaaggcaagaaggcagatg

tacatggtccctgtgttcca

81

0.51

20

35

25523850

ttagcgatgttgagcgttttt

ttcccttaagaaataggcagagg

92

Excluded

21

22

41896467

tgcaaaggagtgggaattatc

tggatgttaaaaacctggtatattgt

164

0.37

22

30

32665884

ccaagccccttccaatacta

tttccaaggtcccaccacta

92

0.29

23

10

55417044

tgctttgcatgttacattcttca

catgtcatagtcacatgctgtacg

151

0.32

24

22

20849044

tattgctgccctgtttcaga

gctgaaggaaatatctgttgaatg

102

0.16

25

24

40849741

ctgcggtctcacatccttag

tgagggggatttgatctctt

69

0.14

26

31

8148287

tctgctcaggtttagccttg

ggatgcaagaaaatctgctg

80

0.43

27

3

67261495

ttactcccagctctgtgcat

gacccaggtggggatatcta

88

0.06

28

26

37097342

tgcccccactactcttgc

aaagggtgatggtcctttga

98

0.09

29

1

109880549

tgttgagcccttgaaatgag

agcgaaaagtggcagtgg

68

0.51

30

13

20047698

tggctgccccatcttatg

cacaatggcagaacacgag

78

0.06

31

10

13999933

gccttcttcctctgcctct

ctcaggcaggcaaataaaaa

90

0.13

32

5

6092689

gcttgggaaatcatggtca

gctaaggaaagcaagctgga

100

0.50

33

3

52499600

tctgactggcctccttcg

attcaagtgtgcccgagag

67

0.51

34

2

87005110

gccgccgtgtcttgtc

cgaatgcgtgcttaccg

80

0.07

35

5

16794632

cgatgctggtgaggaagc

ccatccctgagccacct

91

Excluded

36

1

40637985

aagggccgatgccagt

caggttcttgtttccccaaa

100

0.42

37

14

16593885

cccaggtgccccttattt

ggctcatgctgctctgg

110

0.00

38

38

3128143

gcttcccttgtttctttcca

tgcccatgtaccaaatgaa

121

0.51

39

6

78974466

gtagggcaagcggcaag

tgcttcctggacatttgga

110

0.14

40

4

68490768

ttgcttgggaacatggag

gcccttgtcatccactagga

121

0.00

41

1

41518626

cctggtgcaggttgcag

ccttcggagcccatgc

106

0.42

42

19

29399024

caggacacttgcaccagatt

gagcagaggtgaggctgaa

120

0.00

43

12

27463695

cagtagccaaattgtggaagc

accacgtagtcttgacccattc

68

0.30

44

16

10834862

gttcccttctcagaggacca

caatgagtgaagggggtcag

69

0.00

45

14

38539141

gagtggcacacgagcactt

gcaggactgtctggaggttg

68

0.31

46

8

60840667

tgcctgagggagctgtatatg

tctcattgtggagcaaagacat

75

0.51

47

5

36083663

gctttgttgtaagcagcgata

tgtgagaaactccattgcctta

74

0.21

48

7

53313567

agaaggggcagacttgagg

tccctcatttcacaagctga

75

0.19

49

1

88201810

tggctcattgatttgtgattct

ggccagctcttcttgttgag

78

0.00

50

14

61925547

gggttctctagggagatgacaa

aggacccaagtggattctga

83

Excluded

51

7

17212546

gtcatggtgacatcgcagtt

gcctcatgccaatgagagac

85

0.12

52

2

67041786

gatggccgattgtacatcaa

tggttgcagggaagattagg

95

0.34

53

5

3965764

ccgtctagttgtcgggtgtt

tgcagtatttagggtggagga

94

0.43

54

34

24388648

cccttgtaaaggggaggaga

tggctctgaatttaggcattt

94

0.48

55

12

23053279

agctctcctgctgtgattttt

tgcagacaaatggactgaaga

98

0.44

56

20

29687857

tgagcacgaagaggtagagaag

tcaagtgcaagtcaccaaact

100

0.43

57

30

37964459

cgtgaatggtccaaaatgat

catcagcatttccagagttctt

100

0.26

58

13

42973844

tttctgggcaaaaacagtga

tttagatgggagggaatggtt

108

Excluded

59

5

91665974

accttctgtttcccctttgg

agagcgcagcagagatgact

103

0.00

60

4

43098715

gtttacaccacccagcctga

aggcagttacaggcattaatca

109

0.40

61

20

40585796

cccatccctgaggaagagag

ggacacccgcatttctgtc

114

0.12

62

7

8798933

cccagaaaacaagagaaggaaa

tgttggcagatctcatggtc

114

0.00

63

14

23314695

acccaccagattggctaaaa

tcgaacaggtccagtttacatt

116

0.26

64

26

35769409

cctggcttaaccccttacct

aaccgctatcccacattctg

96

0.00

65

4

56495029

tcccactgtagcttgaaaacg

ttcaggtattgctgtccaaaaa

95

0.51

66

17

19537687

atgctttgcagagatgcttg

tgctcatgtcagaacagagagg

94

0.31

67

31

26928202

atgaacaagcaccccaaaac

cagtccacttcaatgcacca

68

0.27

68

10

66801300

ccccaaattaagggaagttca

tccatgaccaaatctgcatc

70

0.12

69

10

63275151

tccagaacttggagagaatcaa

tccaggcaagactatgagca

70

0.30

70

5

58727403

ctggaccacatatggcttga

tgccggagagatacgtgtaa

72

0.00

71

5

29583832

ccacacagtgttgcctgtagt

ggaaagcacagaaagttgtgaa

73

0.49

72

11

25068367

cccctgcttgtgctctctc

ctctcagcaacccacagagat

75

0.49

73

19

54304531

aagccttgcacttgagcttg

ccattggaaaggcacgtact

77

0.27

74

30

39573069

gcttttgtcatgaaacaccaa

ccaccagatgctcaagtctg

79

0.48

75

19

55236292

gcccacagggtctttattttt

gcttgggtctcttcctctctc

78

0.33

76

3

53761240

ctgtggtgcagcggtttag

ggagcctgacatgggactt

78

0.00

77

4

90768017

gttctccctgtgtctgactgtt

aaagaccaaggggtgaaaga

84

0.13

78

11

57430384

agggacagacccactaagtgtc

tccttaggcgacatggagac

86

Excluded

79

36

32128918

tgatatagccgaagtcaggaag

aatggaaagatcatccagacag

89

0.40

80

14

49479392

tttcaaattgctgaatgttgg

ccctggtctccaggatcac

89

0.47

81

27

13108059

cagccaattggacacaaaaa

aaaatcaagatgtcagcagagg

88

0.00

82

6

61627505

gtcatgatcccatggtccta

gtagaggggcagagggagag

88

0.00

83

36

14699428

gtgttttcttttgggcaagg

tgcaaccaacacacagatga

92

0.49

84

32

36108071

cccagtgttggtcacatataca

gcgatgaaaattgggaaaga

96

Excluded

85

17

57586353

gtgattagggttgaggggaga

ttttccatcaaggtttgtcca

97

0.42

86

5

16750608

aattttccaggaggctttgg

ttccctcctgctgatctagg

98

0.06

87

19

43306776

tggggtaaatcagtgagtgaag

ggcattaagagaagcctgctg

99

0.07

88

29

43945653

aacccgaataacattaggagga

tgggtttaagctggttacgg

104

0.51

89

5

31951980

cccagaaatccacttaatgacc

tgtgttaccagggctaggttc

104

0.44

90

7

50783779

ggttagcttagctcctctccaa

agccacatgctgaaaggaag

104

0.00

91

31

10957463

ttggcaactgccttacaataaa

ttgaatgtggacatgaaacaaa

106

0.47

92

16

6629437

gaaatgggaaggttttattcca

ggtgctgacaacagaaaacct

109

0.46

93

5

75136583

aggacacagacagatgtgagga

ccgaagaggaatctgcactc

111

0.00

94

3

89213750

gagaacttcgatgtgagggaat

ctctcccaccaaaaatctcct

113

0.29

95

21

51457175

aggcattcagggtgttaaaaa

tggtgaactggaaagtagctga

108

0.51

96

12

53379600

ttcccaaggagttggagaga

gctgagggcagctgtgttat

68

0.00

97

14

58723304

ccctgtggtaaccatcaacc

caaagtgaacaagcaaagcaa

67

0.51

98

3

11002853

ccactggccctaagtgactg

ttagggttttaaaggctgtgc

70

0.06

99

30

30015918

tcaggttttggatttgaagga

taagcacaaccattagctcca

72

0.06

100

7

65831405

gaggttcaaatttcccatatcc

gggatccatgcaaaatagttc

73

0.37


Väli et al. BMC Genetics 2008 9:8   doi:10.1186/1471-2156-9-8

Open Data