Table 2

Primer sequences.

Name

Position

Direction

Sequence 5'-3'


ML5'-1

5'-UTR

Forward

GACTGCCCGTGGCCCCATTATTTG

ML1F

5'-UTR

Forward

GCTTTAAGACCGGTTGGATCTAC

SJ93

Exon 1

Forward

GGGGAGGAAGCTGGATCTCTC

RACE4F

Exon1

Forward

ATGGGGAGGAAGCTGGATCTCTCCAAG

RACE2R

Exon 1

Reverse

ACCTCCCAGACATGCTTGGCCTCCTC

RFLP-F1

Intron 1

Reverse

ACACTGACACAGCTGATAACATCAC

MV2R

Exon 2

Forward

GAAGTGCAAGATAGACCAGGAAAG

RACE1R

Exon 2

Reverse

GCTTGCTGTTCAGCAGGAACTTGAAGG

MV18F

Exon 3

Forward

GAAGGGGAATTCAGCTCTTCTAGG

ML14F

Exon 5–6

Forward

CAGAGTGCTACAGCAGAATGC

BlotE91F

Exon 8–9

Forward

CTCGGGAAGTCAGATTCATGAGC

ML3R

Exon 10

Reverse

CTTTCTCTTCAACTCCTCCTCCTC

ML16F

Exon 12

Forward

GTCTACCTGACTGCTGGGAAGG

RACE5F

Exon 15

Forward

GCCACAGGTCCTCAGGAGGAGGTTC

MV8R

Exon 16

Forward

ATGACTCCTTTGACCGCAACTC

MV6F

Exon 17

Reverse

AGGACAGGTGGGTCATCACTG

ML15R

Exon 17

Reverse

CTCAGGACAGGTGGGTCATCACTG

ML3'-1

3'-UTR

Reverse

GATGAGGCAGGGTGGCAGGACCAG


Only base pair position 103, causing the R35W substitution, was shared by all the lavender phenotypes studied and those that were expected to be heterozygous at this locus.

Vaez et al. BMC Genetics 2008 9:7   doi:10.1186/1471-2156-9-7

Open Data