|
Detail information for MR1-MR5 of the chicken PIT1 gene |
||||||
| Markers |
Source1 |
Variation |
Region |
Primers (forward/reverse) (5' → 3') |
Size (bp)2 |
Enzyme |
|
|
||||||
| MR1 |
Nie et al. 2005 |
57 bp indel |
Intron 2 |
PR1 (gtcaaggcaaatattctgtacc/tgcatgttaatttggctctg) |
387 or 330 |
/ |
| MR2 |
Rs13905611 |
C/T |
Intron 5 |
PR2 (ggaccctctctaacagctctc/gggaagaatacagggaaagg) |
599 |
TaqI |
| MR3 |
Rs13687125 |
A/G |
Intron 5 |
PR2 (as described above) |
599 |
MspI |
| MR4 |
Rs13687127 |
C/T |
Intron 5 |
PR3 (ggggattttgccactttaggg/tgggtaaggctctggcactgt) |
442 |
EcoRI |
| MR5 |
Rs13687128 |
C/T |
Exon 6 (I syn) |
PR4 (tgggaagaacagtttatggc/tggctagcttgtaagggaatc) |
483 |
TasI |
|
1 MR1 was reported by Nie et al. (2005); MR2-MR5 were released by NCBI with accession number of Rs13905611, Rs13687125 Rs13687127, and Rs13687128, respectively. The chromosomal sites for MR1-MR5 were nt 96213503–96213559, nt 96221521, nt 96221553, nt 96222619, and nt 96224228, respectively. 2 indicated length of PCR products | ||||||
Nie et al. BMC Genetics 2008 9:20 doi:10.1186/1471-2156-9-20 |
||||||