Table 2

Quantitative RT-PCR conditions and gene-specific primer sequences.

Gene

Quantitative PCR Primers

Annealing temp.

Reading temp.


Gigaxonin

F: catcgtgactgttggtggag

R: tggcaatgctgtccatgtat

62°C

83°C

Complement C3

F: ctggagcagtcaaggtctacg

R: gctcaatggccatgatgtact

66°C

84°C

Butyrylcholinesterase

F: aacaccgatcctccaaacttc

R: tcgacattgttgagcacgtag

66°C

80°C

Sialyltransferase

F: atacctcactccagcccactt

R: accatgtgctttaccaacagc

66°C

80°C

Fatty acid binding protein 5 (FABP5)

F: agttcagcagctggaaggaag

R: tgaaccaatgcaccatctgta

68°C

83°C

ATP-binding cassette A6 (ABCA6)

F: actcaccgtgaaggaaaacct

R: aagaccccaccttcttttcaa

66°C

84°C

Meltrin alpha

F: agtcaactcagcgagtgcttc

R: ggcacttggtgtggatattgt

66°C

86°C

ATP-binding cassette B4 (ABCB4)

F: ctcgatggtcaagaagcaaag

R: ttttgacctcctgagagctga

66°C

84°C

Acyl coenzyme A: cholesterol acyltransferase

F: ctgattccagaagccactgag

R: ctcttctgaggcaccctcttt

66°C

85°C

Leptin

F: ccaaaaccctcatcaagacaa

R: gctcttagagaaggccagcac

66°C

86°C


Leung et al. BMC Genetics 2007 8:6   doi:10.1186/1471-2156-8-6

Open Data