Table 4

Oligonucleotide sequences of capture probe P1, detection probe P2, synthetic targets, and PCR primers.

SNP

Oligonucleotide sequence


rs10504255 P1-A

ALD-AAAAAAAAAAAACCTGAGCACTAGCCAGCTGTGTTCTCAATTCTGTGTGTAA

rs10504255 P1-G

ALD-AAAAAAAAAAAACCTGAGCACTAGCCAGCTGTGTTCTCAATTCTGTGTGTAG

rs10504255 P2

Phosphate-CTCTTTCCCAATATTTCAAT-biotin

rs10504255 Target for P1-A

ATTGAAATATTGGGAAAGAGTTACACACAGAATTGAGAACA

rs10504255 Target for P1-G

ATTGAAATATTGGGAAAGAGCTACACACAGAATTGAGAACA

rs10504255 Forward

TAAACCTGCCTTGTCACGC

rs10504255 Reverse

AGTTGCAAACGCTGGTTG

rs8192879 P1-C

ALD-AAAAAAAAAAGAAAAAACAATCTGCCAATTAGAATACATATCTTTTCTTC

rs8192879 P1-T

ALD-AAAAAAAAAAGAAAAAACAATCTGCCAATTAGAATACATATCTTTTCTTT

rs8192879 P2

Phosphate-GGAGACGGGATCTCACTAAG-biotin

rs8192879 Target for P1-C

CTTAGTGAGATCCCGTCTCCGAAGAAAAGATATGTATTCTA

rs8192879 Target for P1-T

CTTAGTGAGATCCCGTCTCCAAAGAAAAGATATGTATTCTA

rs8192879 Forward

ACCTGTAGTCTTAGCTACTCG

rs8192879 Reverse

CCTTAGGAAAAAACAATCTGCC

rs11786580 P1-C

ALD-AAAAAAAAAACATTTACAAGAACCTATTTTTATCCATATACTATCTGATGC

rs11786580 P1-T

ALD-AAAAAAAAAACATTTACAAGAACCTATTTTTATCCATATACTATCTGATGT

rs11786580 P2

Phosphate-TGCGTGGCGATCACCGCTGC-biotin

rs11786580 Target for P1-C

GCAGCGGTGATCGCCACGCAGCATCAGATAGTATATGGATA

rs11786580 Target for P1-T

GCAGCGGTGATCGCCACGCAACATCAGATAGTATATGGATA

rs11786580 Forward

TCTAGGTGTTTAATGCAGCTTC

rs11786580 Reverse

GTCCCTTTATGCCTTTACCG

rs8192874 P1-C

ALD-AAAAAAAAAATTCTCGTGCCTCAAGCTCTCTGCCAGTTTCTCCCGGGCAC

rs8192874 P1-T

ALD-AAAAAAAAAATTCTCGTGCCTCAAGCTCTCTGCCAGTTTCTCCCGGGCAT

rs8192874 P2

Phosphate-TGTGCGCAGTCCTGAACATG-biotin

rs8192874 Target for P1-C

CATGTTCAGGACTGCGCACAGTGCCCGGGAGAAACTGGCAG

rs8192874 Target for P1-T

CATGTTCAGGACTGCGCACAATGCCCGGGAGAAACTGGCAG

rs8192874 Forward

TCAGTTCTGAGATGCTTTCCC

rs8192874 Reverse

AGTCTTTCCAGCCCTGGTAG

rs2162459 P1-A

ALD-AAAAAAAAAATCTCTAGAGGTGGTTCACCCGTTTGCCTGTCAGACACAAA

rs2162459 P1-G

ALD-AAAAAAAAAATCTCTAGAGGTGGTTCACCCGTTTGCCTGTCAGACACAAG

rs2162459 P2

Phosphate-TGTATGATAGACATGGATGA-biotin

rs2162459 Target for P1-A

TCATCCATGTCTATCATACATTTGTGTCTGACAGGCAAACG

rs2162459 Target for P1-G

TCATCCATGTCTATCATACACTTGTGTCTGACAGGCAAACG

rs2162459 Forward

AAATTGCAGAGCACAGCC

rs2162459 Reverse

TCAAAGTTTGAAGTCAGTGGG

rs3808607 P1-G

ALD-AAAAAAAAAACAAAGCAATCAGAGACCTGCAATACTTGATAAGTTGAAGG

rs3808607 P1-T

ALD-AAAAAAAAAACAAAGCAATCAGAGACCTGCAATACTTGATAAGTTGAAGT

rs3808607 P2

Phosphate-TCTCTCAAATATATGTTGAC-biotin

rs3808607 Target for P1-G

GTCAACATATATTTGAGAGACCTTCAACTTATCAAGTATTG

rs3808607 Target for P1-T

GTCAACATATATTTGAGAGAACTTCAACTTATCAAGTATTG

rs3808607 Forward

AGTCCACAGGTATCAGAAGTG

rs3808607 Reverse

CCCCAGGTCCGAATGTTAAG

rs7833904 P1-A

ALD-AAAAAAAAAACAGGAGAAAGCGTAAGTGCCCTGACAAAGAAAAGAGGTAA

rs7833904 P1-T

ALD-AAAAAAAAAACAGGAGAAAGCGTAAGTGCCCTGACAAAGAAAAGAGGTAT

rs7833904 P2

Phosphate-AGTTGCCAGAAAACCTGGCA-biotin

rs7833904 Target for P1-A

TGCCAGGTTTTCTGGCAACTTTACCTCTTTTCTTTGTCAGG

rs7833904 Target for P1-T

TGCCAGGTTTTCTGGCAACTATACCTCTTTTCTTTGTCAGG

rs7833904 Forward

AATGTGAGCAAGAAAGCCC

rs7833904 Reverse

GAACTCAGTTTATTTTGCCAGG

rs1125226 P1-A

ALD-AAAAAAAAAACAACTGGTTCATCAGACTTGCTGCGACCAATTAACCTTGA

rs1125226 P1-C

ALD-AAAAAAAAAACAACTGGTTCATCAGACTTGCTGCGACCAATTAACCTTGC

rs1125226 P2

Phosphate-CAGCTCAGGGAGAGAGAGAG-biotin

rs1125226 Target for P1-A

CTCTCTCTCTCCCTGAGCTGTCAAGGTTAATTGGTCGCAGC

rs1125226 Target for P1-C

CTCTCTCTCTCCCTGAGCTGGCAAGGTTAATTGGTCGCAGC

rs1125226 Forward

TTTCTCTCTCTCCCTCTTTCTC

rs1125226 Reverse

CTGGTTCATCAGACTTGCTG

rs1023652 P1-C

ALD-AAAAAAAAAAAAAATTCAAGTACCATAATATTCACCCCTTTAAAGAGTAC

rs1023652 P1-G

ALD-AAAAAAAAAAAAAATTCAAGTACCATAATATTCACCCCTTTAAAGAGTAG

rs1023652 P2

Phosphate-AATTCAAAATTTCTAGCATA-biotin

rs1023652 Target for P1-C

TATGCTAGAAATTTTGAATTGTACTCTTTAAAGGGGTGAAT

rs1023652 Target for P1-G

TATGCTAGAAATTTTGAATTCTACTCTTTAAAGGGGTGAAT

rs1023652 Forward

TGGAATGCCAGTTACCCCAC

rs1023652 Reverse

GGTGATGGTCACACAATCTTTG

1302 delTT P1-TT

ALD-AAAAAAAAAATGTATTTTTATTGCAGACTTTTAAATATGATAGGTATCTT

1302 delTT P1-DEL

ALD-AAAAAAAAAATTTGTATTTTTATTGCAGACTTTTAAATATGATAGGTATC

1302 delTT P2

Phosphate-GATGAAAACGGGAAGACAAA-biotin

1302 delTT Target for P1-TT

TGTCTTCCCGTTTTCATCAAGATACCTATCATATTTAAAA

1302 delTT Target for P1-DEL

TGTCTTCCCGTTTTCATCGATACCTATCATATTTAAAA

1302 delTT Forward

ACTAGCTTAAAGGCGGTTTTC

1302 delTT Reverse

CGATCCAAAGGGCATGTAG


* Shadows indicate SNP nucleotides in P1 probe and target sequences.

Nakamoto et al. BMC Genetics 2006 7:29   doi:10.1186/1471-2156-7-29

Open Data