Table 1 |
|||
|
Primers for PCR-SSCP analysis of p66Shc gene |
|||
|
Amplicon |
Product size (bp) |
Forward primer (5'-) |
Reverse primer (5'-) |
|
|
|||
|
CH2 |
352 |
gcccctctttcacctcaact |
atgtcctggaggaggggtag |
|
Promoter-1 |
238 |
cagagaagaggctccacgtt |
ggggcaggagatccatagtt |
|
Promoter-2 |
247 |
cccacccccactttacttct |
aacgtggagcctcctctctg |
|
Promoter-3 |
330 |
aggacaggaagggaaatgct |
agtgctgactcacaggctca |
|
|
|||
|
Forward and reverse primer sequences are all 5'. Promoter-1 fragment starts at nucleotide -222 from start codon of exon1; Promoter-2 fragment starts at nucleotide -449 from start codon of exon1; Promoter-3 fragment starts at nucleotide -637 from start codon of exon1 of p66Shc gene. |
|||
|
Sentinelli et al. BMC Genetics 2006 7:14 doi:10.1186/1471-2156-7-14 |
|||
