Email updates

Keep up to date with the latest news and content from BMC Genetics and BioMed Central.

Open Access Research article

Polymorphism discovery and association analyses of the interferon genes in type 1 diabetes

Gerard AJ Morris, Christopher E Lowe, Jason D Cooper, Felicity Payne, Adrian Vella, Lisa Godfrey, John S Hulme, Neil M Walker, Barry C Healy, Alex C Lam, Paul A Lyons and John A Todd*

Author Affiliations

Juvenile Diabetes Research Foundation/Wellcome Trust Diabetes and Inflammation Laboratory, Cambridge Institute for Medical Research, University of Cambridge, Addenbrooke's Hospital, Hills Road, Cambridge, CB2 2XY, UK

For all author emails, please log on.

BMC Genetics 2006, 7:12  doi:10.1186/1471-2156-7-12


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2156/7/12


Received:25 November 2005
Accepted:22 February 2006
Published:22 February 2006

© 2006 Morris et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The aetiology of the autoimmune disease type 1 diabetes (T1D) involves many genetic and environmental factors. Evidence suggests that innate immune responses, including the action of interferons, may also play a role in the initiation and/or pathogenic process of autoimmunity. In the present report, we have adopted a linkage disequilibrium (LD) mapping approach to test for an association between T1D and three regions encompassing 13 interferon alpha (IFNA) genes, interferon omega-1 (IFNW1), interferon beta-1 (IFNB1), interferon gamma (IFNG) and the interferon consensus-sequence binding protein 1 (ICSBP1).

Results

We identified 238 variants, most, single nucleotide polymorphisms (SNPs), by sequencing IFNA, IFNB1, IFNW1 and ICSBP1, 98 of which where novel when compared to dbSNP build 124. We used polymorphisms identified in the SeattleSNP database for INFG. A set of tag SNPs was selected for each of the interferon and interferon-related genes to test for an association between T1D and this complex gene family. A total of 45 tag SNPs were selected and genotyped in a collection of 472 multiplex families.

Conclusion

We have developed informative sets of SNPs for the interferon and interferon related genes. No statistical evidence of a major association between T1D and any of the interferon and interferon related genes tested was found.

Background

Autoimmune diseases are often common chronic conditions that involve immune attack of one or more organ systems and affect approximately 5% of the population. Although the specific aetiologies of human autoimmune diseases remain largely unknown, in the case of type 1 diabetes [OMIM: 222100], four susceptibility loci have been identified and convincingly replicated: the HLA class II genes on chromosome 6p21[1], the insulin gene on chromosome 11p15[2,3], the CTLA-4 gene on chromosome 2q33[4,5], and the PTPN22 gene on chromosome 1p13[6,7]. Evidence for a fifth gene has recently been reported, IL2RA (CD25), encoding the α-subunit of the IL-2 receptor on chromosome 10p15[8]. Here, we have adopted a linkage disequilibrium mapping approach to test for an association between T1D and three regions encompassing 13 IFNA genes (IFNA1 [OMIM: 147660], IFNA2 [OMIM: 147562], IFNA4 [OMIM: 147564], IFNA5 [OMIM: 147565], IFNA6 [OMIM: 147566], IFNA7 [OMIM: 147567], IFNA8 [OMIM: 147568], IFNA10 [OMIM: 147577], IFNA13 [OMIM: 147578], IFNA14 [OMIM: 147579], IFNA16 [OMIM: 147580], IFNA17 [OMIM: 147583] and IFNA21 [OMIM: 147584]), IFNW1 [OMIM: 147553], IFNB1 [OMIM: 147640], IFNG [OMIM: 147570] and ICSBP1 [OMIM: 601565], using tag SNPs [9-11] in a collection of 472 multiplex families. We have previously shown that the tag SNP approach can reduce genotyping costs by approximately two-thirds [10-12].

The type I interferons, including the IFNAs, IFNB1 and IFNW1, are a large, evolutionarily-conserved family of homologous pro-inflammatory antiviral, immune-regulatory, cytokines, encoded by a cluster of single exon genes in a 400 kb region of human chromosome 9p21.3, and the orthologous ~400 kb region of mouse chromosome 4. The type II interferon, IFNG, encoded by a four-exon gene on chromosome 12, also exhibits antiviral activity but in contrast to the type I interferons, its main biological activity appears to be immunomodulatory. Type I interferons have increased prior probability in terms of being associated with susceptibility to human immune-mediated disease because this region has been linked with susceptibility to a number of mouse models of autoimmune diseases and related traits [13-16], although, to date, there is no evidence of linkage in humans.

We also assessed the related ICSBP1, the product of which, a transcription factor of the interferon regulatory factor (IRF) family, plays a major role in interferon signalling. Although nine distinct IRFs have been described[17], we analysed ICSBP1, specifically because chromosome 16q24.1, the region containing the nine-exon gene encoding ICSBP1, has shown some evidence of linkage to T1D previously [18-20].

Results

IFNA gene cluster tag SNP analysis

The resequencing of 13 IFNA genes in 32 T1D cases identified 152 polymorphisms (see 1), 144 of which were SNPs and eight were deletion/insertion polymorphisms (DIPs); of these, 64 SNPs and eight DIPs were novel when compared with dbSNP build 124. Thirty coding SNPs were identified in nine out of the 13 IFNA genes, of which six were synonymous, and 24 were non-synonymous, including the previously known premature stop codon polymorphism[21,22], in the IFNA10 gene, at predicted amino acid residue position 20 [Cys-Stop]. Seventy-five polymorphisms had a minor allele frequency (MAF) < 0.1 and were consequently not included in the tag SNP selection. As the LD within and between the 13 IFNA genes is strong, a set of tag SNPs was selected for the region encompassing the 13 IFNA genes. From the 77 polymorphisms (MAF ≥ 0.1), 20 tag SNPs were selected (minimum R2 = 0.81) and genotyped in the family collection. All tag SNP genotypes in parents and T1D affected offspring were in Hardy-Weinberg equilibrium (HWE). The multilocus test[10,11]P-value was 0.35 (1,335 parent-child trios, χ202 = 21.9; see 2).

Additional File 1. SNPs identified in the IFNA region. Novel SNPs are denoted by "ss" numbers and previously published SNPs are denoted by "rs" numbers. The gene refers to the IFNA gene in closest proximity to the SNP. Minor allele frequencies are based on the sequencing panel as listed in Table 1. R2 values for non-typed SNPs. Tag SNPs are marked in bold. UTR, untranslated region.

Format: XLS Size: 36KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Additional File 2. Genotyping summary for IFNA tag SNPs. Genotype summary for the IFNA tag SNPs. Minor allele frequencies are based on parental genotypes. Number of parent-child trios obtained by population.

Format: XLS Size: 17KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

IFNB1 tag SNP analysis

The resequencing of IFNB1 in 32 T1D cases identified 21 polymorphisms (including one synonymous SNP), 18 of which were SNPs and three were DIPs; of these, five SNPs and three DIPs were novel (see 3). Ten polymorphisms had a MAF < 0.05 and were consequently not included in the tag SNP selection. From the 11 polymorphisms (MAF ≥ 0.05), four tag SNPs were selected (minimum R2 = 0.83) and genotyped in the family collection. All tag SNP genotypes in parents and T1D affected offspring were in HWE, except for rs10811465, which deviated from HWE in the parents (P = 0.0088; excess homozygotes). As there were no apparent errors with the genotype scoring, this SNP was re-typed using an alternative Taqman assay to check for a genotyping error. We found a high correlation of genotypes between the two assays (correlation coefficient = 0.99) and consequently, that the SNP genotypes still deviated from HWE in parents (P = 0.0012; excess homozygotes). Blast searches of the primer and probe sequences suggested that the assays should be specific, reducing the likelihood of deviation due to gene duplication. As the multilocus test does not assume HWE[8], we proceeded to analyse the set of tag SNPs. The multilocus test P-value was 0.12 (1,427 trios, χ42 = 7.2; see 4).

Additional File 3. SNPs identified in the IFNB1 region. Novel SNPs are denoted by "ss" numbers and previously published SNPs are denoted by "rs" numbers. R2 values for non-typed SNPs. Tag SNPs are marked in bold. UTR, untranslated region.

Format: XLS Size: 16KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Additional File 4. Genotyping summary for IFNB1 tag SNPs. Genotype summary for the IFNB1 tag SNPs. Minor allele frequencies are based on parental genotypes. Number of parent-child trios obtained by population.

Format: XLS Size: 14KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

IFNG tag SNP and single SNP analysis

The SeattleSNP variation discovery resource (http://pga.gs.washington.edu/) in 23 European Americans identified 13 polymorphisms in their resequencing of IFNG, 12 of which were SNPs and one was a DIP. Six polymorphisms had a MAF < 0.1 and were consequently not included in the tag SNP selection[23]. From the seven polymorpisms (MAF ≥ 0.1), four tag SNPs were selected (minimum R2 = 0.84) and genotyped in the family collection (see 5). All tag SNP genotypes in parents and T1D affected offspring were in HWE. The multilocus test P-value was 0.43 (1,417 trios, χ42 = 3.8; see 6).

Additional File 5. SNPs identified in the IFNG region. Novel SNPs are denoted by "ss" numbers and previously published SNPs are denoted by "rs" numbers. R2 values for non-typed SNPs. Tag SNPs are marked in bold. UTR, untranslated region.

Format: XLS Size: 14KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

An additional IFNG SNP was obtained from the literature, rs2430561[24], with a reported association with tuberculosis. This common SNP (MAF = 0.46) was genotyped in the family collection. SNP genotypes in parents and T1D affected offspring were in HWE. The transmission/disequilibrium test[25]P-value was 0.091 (1,157 trios, χ12 = 2.9; see 6).

Additional File 6. Genotyping summary for IFNG tag SNPs and rs2430561. Genotype summary for the IFNG tag SNPs and rs2430561. Minor allele frequencies are based on parental genotypes. Number of parent-child trios obtained by population.

Format: XLS Size: 17KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

IFNW1 tag SNP analysis

The resequencing of IFNW1 in 32 T1D cases identified 23 polymorphisms (see 7), of which 21 were SNPs and two were DIPs; of these, seven SNPs and two DIPs were novel. One SNP had a MAF < 0.05 and was consequently not included in the tag SNP selection. From the 22 polymorphisms (MAF ≥ 0.05), 10 tag SNPs were selected (minimum R2 = 0.88) and genotyped in the family collection. All tag SNP genotypes in parents and T1D affected offspring were in HWE, except for rs12554686, which deviated from HWE in the parents (P = 0.0019; fewer homozygotes than expected under HWE). As there appear to be no obvious errors with the original Invader genotype scoring, this SNP was also re-typed using an alternative Taqman assay to check for a genotyping error. We found a high correlation of genotypes between the two assays (correlation coefficient = 0.96) and consequently, that the SNP genotypes still deviated from HWE in parents (P = 0.0024; fewer homozygotes). As with rs10811465 in IFNB1, blast searches suggested that the assays should be specific, reducing the likelihood of deviation due to gene duplication. The multilocus test P-value was 0.90 (1,401 trios, χ102 = 4.9; see 8).

Additional File 7. SNPs identified in the IFNW1 region. Novel SNPs are denoted by "ss" numbers and previously published SNPs are denoted by "rs" numbers. R2 values for non-typed SNPs. Tag SNPs are marked in bold. UTR, untranslated region.

Format: XLS Size: 16KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Additional File 8. Genotyping summary for IFNW1 tag SNPs. Genotype summary for the IFNW1 tag SNPs. Minor allele frequencies are based on parental genotypes. Number of parent-child trios obtained by population.

Format: XLS Size: 15KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

ICSBP1 tag SNP analysis

The resequencing of ICSBP1 in 32 T1D cases identified 42 polymorphisms, including one non-synonymous and four synonymous SNPs in exon seven of the gene (see 9). Forty of the 42 polymorphisms identified were SNPs and two were DIPs; eight of these SNPs and one DIP were novel. Eleven polymorphisms had a MAF < 0.05 and were consequently not included in the tag SNP selection. From the 31 polymorphisms (MAF ≥ 0.05), seven tag SNPs were selected (minimum R2 = 0.82) and genotyped in the family collection. All tag SNP genotypes in parents and T1D affected offspring were in HWE. The multilocus test P-value was 0.58 (1,411 trios, χ72 = 5.6; see 10).

Additional File 9. SNPs identified in the ICSBP1 region. Novel SNPs are denoted by "ss" numbers and previously published SNPs are denoted by "rs" numbers. R2 values for non-typed SNPs. Tag SNPs are marked in bold. UTR, untranslated region.

Format: XLS Size: 18KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Additional File 10. Genotyping summary for ICSBP1 tag SNPs. Genotype summary for the ICSBP1 tag SNPs. Minor allele frequencies are based on parental genotypes. Number of parent-child trios obtained by population.

Format: XLS Size: 14KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Conclusion

As we found no statistical evidence of an association between T1D and any of the interferon and interferon related genes tested (Table 1). We conclude that the IFNAs, IFNB1, IFNW1, ICSBP1 and IFNG genes do not contribute significantly to T1D in the populations analysed. Of course, it remains possible that there exists a common disease variant in any of these genes, which either has an effect smaller than would be detected with this study size or is in much weaker LD with the tag SNPs than any other polymorphism known to us[12]. However, had we genotyped all the common polymorphisms (45 tags selected from 148 common polymorphisms), we would have been little better able to detect such a variant. The LD mapping approach has provided a cost-effective T1D association study of this complex gene family and, in addition, a better quality polymorphism map for others to use in the genetic analyses of other diseases.

Table 1. Summary of disease association results. Number of individuals in the sequencing panel, number of polymorphisms identified per gene, number of tag SNPs selected. Minor allele frequency cut-off used in tag SNP selection, minimum R2 of each set of tag SNPs, number of trios analysed, χ2 results and multilocus test P values for the IFNA gene cluster, IFNB1, IFNW1 and IFNG.

Methods

Polymorphism discovery

The genes of interest, with the exception of IFNG, were annotated locally[26,27] and displayed through gbrowse[28] within T1DBase[29]. Using these annotations, polymorphisms were identified by resequencing, using a nested PCR approach, the exons, exon/intron boundaries and up to 3 kb of 5' and 3' flanking sequence, in DNA samples from 32 T1D patients. The sequencing reactions were performed using Applied Biosystems (ABI) BigDye terminator chemistry and the sequences were resolved using an ABI 3700 DNA Analyser. Sequence traces were analysed using the Staden package[30] and double-scored by a second operator. In the case of INFG, polymorphisms identified from 23 individuals of European descent were extracted from the SeattleSNP database[31].

Tag SNP selection

Tag SNPs were selected for IFNB1, IFNW1, ICSBP1 and IFNG. However, owing to the high homology and consequent LD among the IFNA cluster (Figure 1), tag SNPs were chosen for the region encompassing the 13 IFNA genes, rather than for each individual gene. The tag SNP approach uses the resequencing genotype data to investigate the ability of a smaller subset of SNPs to predict the genotypes of the remainder. Predictive performance is assessed using a R2 measure (coefficient of determination), which measures the ability to predict each known SNP genotype by linear regression on the tag SNP genotypes[10,11]. Generally we only consider SNPs with a MAF ≥ 0.05. However, as IFNG polymorphisms were extracted from the SeattleSNP database of 23 Caucasian individuals, we increased the MAF ≥ 0.1[23] for the analysis of this gene. Likewise, as a result of the complexity of genotyping SNPs in the IFNA region and the large number of SNPs with a MAF ≥ 0.05, we used a MAF ≥ 0.1 when selecting tag SNPs for the IFNA region. We required the subset of tags SNPs to predict the remaining SNPs with a minimum R2 of 0.8

thumbnailFigure 1. Linkage disequilibrium across the IFNA cluster. The plot displays the pairwise D' relationship between the 77 SNPs with a MAF ≥ 0.1.

DNA collections

Tag SNPs for all genes were genotyped in a family collection consisting of 472 multiplex families from the Diabetes UK Warren 1 collection and 268 multiplex families from the (USA) Human Biological Data Interchange, providing up to 1,427 parent-child trios. Ethical approval by the relevant research ethics committees was obtained for all DNA samples collected, and written informed consent was obtained from the participants.

Genotyping

Genotyping of the tag SNPs was performed using either Taqman (ABI) or Invader (Third Wave Technologies) assays with the exception of rs35085912, a DIP, for which fluorescent primers were designed (Primer1:CGCCTCTTATGTACCCACAAA-FAM Primer2:TTTTTCTGATTGAATCTCCCATT) and size differences discriminated using an ABI3700 DNA analyser. Owing to the exceptionally high degree of sequence homology within the IFNA genes and their 3' and 5' flanking regions it was necessary to modify the standard Taqman genotyping protocol for over half the tag SNPs in this region. This was achieved through a PCR amplification of a sequence specific to the region containing the polymorphism of interest, which was subsequently used as the template for Taqman assay. An initial quality assurance pilot study was carried out on each of the SNP-specific Taqman kits before genotyping on the full T1D family set commenced. A panel of 96 T1D patients were genotyped using each respective Taqman kit. This 96 patient panel included the 32 patients used for the resequencing efforts described above for initial identification of SNPs and allele frequencies. All kits that showed 100% correlation between Taqman kit genotyping results and resequencing results were used to genotype native genomic DNA from the families (i.e. the standard protocol was followed). Those Taqman kits that failed to show 100% concordance with the sequencing data were either: 1) replaced by an alternative tag SNP; or, 2) reassessed through genotyping on the 96 panel after an initial nested PCR amplification step (to the isolated genomic region containing the specific SNP of interest), only those kits that showed 100% concordance with results obtained in the 96 patient DNA genotyping and 32 patient DNA sequencing panels after the nested PCR step were used for genotyping in the T1D family panel. All eight kits requiring nested PCR prior to genotyping showed 100% concordance with sequencing data from the 32 DNA resequencing set.

Statistical analysis

Tag SNPs were analysed using a multilocus test, which essentially tests for an association between T1D and the tag SNPs due to LD with one or more causal variants[10,11]. The programs for the selection of tag SNPs and association analysis used in this paper are implemented in the Stata statistical system[32] and may be downloaded from David Clayton's website[33].

Authors' contributions

GAJM and CEL participated in the design of the study, carried out gene annotation, sequencing, genotyping, data analysis and manuscript preparation. JDC participated in the design of the study, performed data analysis and participated in manuscript preparation. AV carried out gene annotation, sequencing and genotyping. FP, LG and JSH carried out genotyping. NMW coordinated data management.

BCH and ACL participated in genome informatics. PAL participated in the conception and design of the study. JAT participated in the conception, design and coordination of the study and participated in manuscript preparation. All Authors read and approved the final manuscript.

Acknowledgements

We gratefully acknowledge the participation of all T1D patients and family members.Thanks to Sarah Nutland, Helen Stevens, Gillian Coleman, Sarah Field, Trupti Mistry, Sally Clayton, Matthew Hardy, Pamela Lauder, Meeta Maisuria, William Meadows and Sarah Wood for preparing DNA samples, in addition to Diabetes UK and the Human Biological Data Interchange. We also thank Vin Everett, Geoff Dolman and Oliver Burren for data management and bioinformatics support. The Wellcome Trust and the Juvenile Diabetes Research Foundation International have funded this work. Adrian Vella is a Mayo Foundation scholar.

References

  1. Cucca F, Lampis R, Congia M, Angius E, Nutland S, Bain SC, Barnett AH, Todd JA: A correlation between the relative predisposition of MHC class II alleles to type 1 diabetes and the structure of their proteins.

    Hum Mol Genet 2001, 10:2025-2037. PubMed Abstract | Publisher Full Text OpenURL

  2. Bell GI, Horita S, Karam JH: A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus.

    Diabetes 1984, 33:176-183. PubMed Abstract OpenURL

  3. Barratt BJ, Payne F, Lowe CE, Hermann R, Healy BC, Harold D, Concannon P, Gharani N, McCarthy MI, Olavesen MG, McCormack R, Guja C, Ionescu-Tirgoviste C, Undlien DE, Ronningen KS, Gillespie KM, Tuomilehto-Wolf E, Tuomilehto J, Bennett ST, Clayton DG, Cordell HJ, Todd JA: Remapping the insulin gene/IDDM2 locus in type 1 diabetes.

    Diabetes 2004, 53:1884-1889. PubMed Abstract | Publisher Full Text OpenURL

  4. Nistico L, Buzzetti R, Pritchard LE, Van der Auwera B, Giovannini C, Bosi E, Larrad MT, Rios MS, Chow CC, Cockram CS, Jacobs K, Mijovic C, Bain SC, Barnett AH, Vandewalle CL, Schuit F, Gorus FK, Tosi R, Pozzilli P, Todd JA: The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes.

    Hum Mol Genet 1996, 5:1075-1080. PubMed Abstract | Publisher Full Text OpenURL

  5. Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G, Rainbow DB, Hunter KM, Smith AN, Di Genova G, Herr MH, Dahlman I, Payne F, Smyth D, Lowe C, Twells RC, Howlett S, Healy B, Nutland S, Rance HE, Everett V, Smink LJ, Lam AC, Cordell HJ, Walker NM, Bordin C, Hulme J, Motzo C, Cucca F, Hess JF, Metzker ML, Rogers J, Gregory S, Allahabadia A, Nithiyananthan R, Tuomilehto-Wolf E, Tuomilehto J, Bingley P, Gillespie KM, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgoviste C, Savage DA, Maxwell AP, Carson DJ, Patterson CC, Franklyn JA, Clayton DG, Peterson LB, Wicker LS, Todd JA, Gough SC: Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease.

    Nature 2003, 423:506-511. PubMed Abstract | Publisher Full Text OpenURL

  6. Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, MacMurray J, Meloni GF, Lucarelli P, Pellecchia M, Eisenbarth GS, Comings D, Mustelin T: A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes.

    Nat Genet 2004, 36:337-338. PubMed Abstract | Publisher Full Text OpenURL

  7. Smyth D, Cooper JD, Collins JE, Heward JM, Franklyn JA, Howson JM, Vella A, Nutland S, Rance HE, Maier L, Barratt BJ, Guja C, Ionescu-Tirgoviste C, Savage DA, Dunger DB, Widmer B, Strachan DP, Ring SM, Walker N, Clayton DG, Twells RC, Gough SC, Todd JA: Replication of an association between the lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus.

    Diabetes 2004, 53:3020-3023. PubMed Abstract | Publisher Full Text OpenURL

  8. Vella A, Cooper JD, Lowe CE, Walker N, Nutland S, Widmer B, Jones R, Ring SM, McArdle W, Pembrey ME, Strachan DP, Dunger DB, Twells RC, Clayton DG, Todd JA: Localization of a type 1 diabetes locus in the IL2RA/CD25 region by use of tag single-nucleotide polymorphisms.

    Am J Hum Genet 2005, 76:773-779. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  9. Johnson GC, Esposito L, Barratt BJ, Smith AN, Heward J, Di Genova G, Ueda H, Cordell HJ, Eaves IA, Dudbridge F, Twells RC, Payne F, Hughes W, Nutland S, Stevens H, Carr P, Tuomilehto-Wolf E, Tuomilehto J, Gough SC, Clayton DG, Todd JA: Haplotype tagging for the identification of common disease genes.

    Nat Genet 2001, 29:233-237. PubMed Abstract | Publisher Full Text OpenURL

  10. Chapman JM, Cooper JD, Todd JA, Clayton DG: Detecting disease associations due to linkage disequilibrium using haplotype tags: a class of tests and the determinants of statistical power.

    Hum Hered 2003, 56:18-31. PubMed Abstract | Publisher Full Text OpenURL

  11. Clayton D, Chapman J, Cooper J: Use of unphased multilocus genotype data in indirect association studies.

    Genet Epidemiol 2004, 27:415-428. PubMed Abstract | Publisher Full Text OpenURL

  12. Lowe CE, Cooper JD, Chapman JM, Barratt BJ, Twells RC, Green EA, Savage DA, Guja C, Ionescu-Tirgoviste C, Tuomilehto-Wolf E, Tuomilehto J, Todd JA, Clayton DG: Cost-effective analysis of candidate genes using htSNPs: a staged approach.

    Genes Immun 2004, 5:301-305. PubMed Abstract | Publisher Full Text OpenURL

  13. Kono DH, Burlingame RW, Owens DG, Kuramochi A, Balderas RS, Balomenos D, Theofilopoulos AN: Lupus susceptibility loci in New Zealand mice.

    Proc Natl Acad Sci U S A 1994, 91:10168-10172. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  14. Morel L, Rudofsky UH, Longmate JA, Schiffenbauer J, Wakeland EK: Polygenic control of susceptibility to murine systemic lupus erythematosus.

    Immunity 1994, 1:219-229. PubMed Abstract | Publisher Full Text OpenURL

  15. Ochiai K, Ozaki S, Tanino A, Watanabe S, Ueno T, Mitsui K, Toei J, Inada Y, Hirose S, Shirai T, Nishimura H: Genetic regulation of anti-erythrocyte autoantibodies and splenomegaly in autoimmune hemolytic anemia-prone new zealand black mice.

    Int Immunol 2000, 12:1-8. PubMed Abstract | Publisher Full Text OpenURL

  16. Johansson AC, Nakken B, Sundler M, Lindqvist AK, Johannesson M, Alarcon-Riquelme M, Bolstad AI, Humphreys-Beher MG, Jonsson R, Skarstein K, Holmdahl R: The genetic control of sialadenitis versus arthritis in a NOD.QxB10.Q F2 cross.

    Eur J Immunol 2002, 32:243-250. PubMed Abstract | Publisher Full Text OpenURL

  17. Nguyen H, Hiscott J, Pitha PM: The growing family of interferon regulatory factors.

    Cytokine Growth Factor Rev 1997, 8:293-312. PubMed Abstract | Publisher Full Text OpenURL

  18. Mein CA, Esposito L, Dunn MG, Johnson GC, Timms AE, Goy JV, Smith AN, Sebag-Montefiore L, Merriman ME, Wilson AJ, Pritchard LE, Cucca F, Barnett AH, Bain SC, Todd JA: A search for type 1 diabetes susceptibility genes in families from the United Kingdom.

    Nat Genet 1998, 19:297-300. PubMed Abstract | Publisher Full Text OpenURL

  19. Cox NJ, Wapelhorst B, Morrison VA, Johnson L, Pinchuk L, Spielman RS, Todd JA, Concannon P: Seven regions of the genome show evidence of linkage to type 1 diabetes in a consensus analysis of 767 multiplex families.

    Am J Hum Genet 2001, 69:820-830. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  20. Concannon P, Erlich HA, Julier C, Morahan G, Nerup J, Pociot F, Todd JA, Rich SS: Type 1 diabetes: evidence for susceptibility Loci from four genome-wide linkage scans in 1,435 multiplex families.

    Diabetes 2005, 54:2995-3001. PubMed Abstract | Publisher Full Text OpenURL

  21. Miterski B, Jaeckel S, Epplen JT, Pohlau D, Hardt C: The interferon gene cluster: a candidate region for MS predisposition? Multiple Sclerosis Study Group.

    Genes Immun 1999, 1:37-44. PubMed Abstract | Publisher Full Text OpenURL

  22. Wieczorek S, Dahmen N, Kasten M, Epplen JT, Gencik M: A rare form of narcolepsy (HLA-DR2-) shows possible association with (functionally relevant) alpha-interferon gene polymorphisms.

    Psychiatr Genet 2004, 14:47-51. PubMed Abstract | Publisher Full Text OpenURL

  23. Carlson CS, Eberle MA, Rieder MJ, Yi Q, Kruglyak L, Nickerson DA: Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium.

    Am J Hum Genet 2004, 74:106-120. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  24. Rossouw M, Nel HJ, Cooke GS, van Helden PD, Hoal EG: Association between tuberculosis and a polymorphic NFkappaB binding site in the interferon gamma gene.

    Lancet 2003, 361:1871-1872. PubMed Abstract | Publisher Full Text OpenURL

  25. Spielman RS, McGinnis RE, Ewens WJ: Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM).

    Am J Hum Genet 1993, 52:506-516. PubMed Abstract OpenURL

  26. Burren OS, Healy BC, Lam AC, Schuilenburg H, Dolman GE, Everett VH, Laneri D, Nutland S, Rance HE, Payne F, Smyth D, Lowe C, Barratt BJ, Twells RC, Rainbow DB, Wicker LS, Todd JA, Walker NM, Smink LJ: Development of an integrated genome informatics, data management and workflow infrastructure: a toolbox for the study of complex disease genetics.

    Hum Genomics 2004, 1:98-109. PubMed Abstract | Publisher Full Text OpenURL

  27. Smink LJ, Helton EM, Healy BC, Cavnor CC, Lam AC, Flamez D, Burren OS, Wang Y, Dolman GE, Burdick DB, Everett VH, Glusman G, Laneri D, Rowen L, Schuilenburg H, Walker NM, Mychaleckyj J, Wicker LS, Eizirik DL, Todd JA, Goodman N: T1DBase, a community web-based resource for type 1 diabetes research.

    Nucleic Acids Res 2005, 33(Database):D544-549. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  28. Gbrowse [http://www.gmod.org/?q=node/71] webcite

  29. T1DBase [http://t1dbase.org/cgi-bin/dispatcher.cgi/Welcome/display] webcite

  30. Bonfield JK, Rada C, Staden R: Automated detection of point mutations using fluorescent sequence trace subtraction.

    Nucleic Acids Res 1998, 26:3404-3409. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  31. SeattleSNPs [http://pga.gs.washington.edu/education.html] webcite

  32. Stata [http://www.stata.com/] webcite

  33. Genassoc [http://www-gene.cimr.cam.ac.uk/clayton/software/] webcite