Table 1

Six new nuclear loci for each of two Collembola species. Markers were developed using four PCR-based methods (labeled A-D) in conjunction with SSCP plus DNA sequencing. Pseud., Pseudachorutinae n. sp.; Acanth., Acanthanura n. sp.

Taxon/locus

Primer

Sequence (5' to 3')

Gene amplified

Method

Source of primers used for initial amplification (primer names)


Pseud.

Sm2

Sm2-Fa

GAAACGGGTGCTGGTTSRAGG

Anon. nDNA

A

Operon Technologies (A07, A09)

Sm2-R

GGGTAACGCCRTTGGAAACAG

Sm4

Sm4-F

GAATTGGTGGGAGATCTCTC

Anon. nDNA

C

[2] (ATPSα f1, ATPSα r1)

Sm4-R

TGTCGTCCGTCTATGATTCG

Sm6

Sm6-F

CTGAATGCCGTCGAAACGTAAAC

Anon. nDNA

B

[57] (M49-F), [58] (myz3-R)

Sm6-R

GTTGGTTTACCTGTTTTAAATG

Sm8

Sm8-F

AGTGGGATTTTAGGATGGCAGG

Anon. nDNA

A/B

[57] (M49-F), Operon Technologies (A07)

Sm8-R

CCAAGACTAAGATTGAGAAGAAGTC

SmEF-1α

UcEF-Fa

see below

EF-1α intron

C

This study (UcEF-F), [1] (EF2)

SmEF-R

CCAATMCCACCAATTTTGTAGAC

Sm150

Sm150-F

ATCCTACTCAAAACTCAAG

Anon. nDNA

D

Not applicable

Sm150-R

ACCCTTGGATTTGGAATC


Acanth.

Uc3

Uc3-Fa

CAGCGCGGTTTGGGTGTATA

Anon. nDNA

A

Operon Technologies (A07, A10)

Uc3-R

GTGATCGCAGAAATCCCCGCA

Uc180

Uc180-Fa

CCAACTCAAGTTCGGATGAC

Anon. nDNA

D

Not applicable

Uc180-R

CAAAGCGCTTAACTGGGTC

Uc44

Uc44-F

GATTATTACCAATCGCTATTGG

Anon. nDNA

A

Operon Technologies (A07, A09)

Uc44-R

GGGTAACGCCAATTTAAGGTG

UcEF-1α

UcEF-Fa

CCGAGAAGATGTCCTGGTTC

EF-1α intron

C

[1] (EF0, EF2)

UcEF-R

CGGGCACTGTTCCAATCC

UcANT

UcANT-F

CAGTGTCTCMGTKCAAGGAATC

ANT intron

C

[2] (ANTf1, ANTr1)

UcANT-R

MTTGGGCGATWAKCCAKGAAAC

UcWnt

UcWnt-F

AGAATAAGTTCCGTCGTGCTG

Wnt

C

[59] (wg1a, wg2a)

UcWnt-R

GGATTGGAGTCGCAGTAGGTC


aPrimer used for sequencing.

Garrick and Sunnucks BMC Genetics 2006 7:11   doi:10.1186/1471-2156-7-11

Open Data