Table 3

Primer used for genotyping

SNP

left primer

right primer

extension primer

stop mix


hCV2880804

ACGTTGGATG-CTGGGATACTTCTGAGAGTG

ACGTTGGATG-TTTTCCCTGGAAAGTTTGGG

CCATTGTCCTGGTATAACCA

ACG

rs2228570

ACGTTGGATG-TCAAAGTCTCCAGGGTCAGG

ACGTTGGATG-AGACCTCACAGAAGAGCACC

CCCTGCTCCTTCAGGGA

ACG

rs3819545

ACGTTGGATG-AATGGTGGTTACTGCAGCTC

ACGTTGGATG-GAAACCAGTCCTCTGTCATG

TAGGTTCGGTCTTTGGCT

ACG

rs3782905

ACGTTGGATG-GGGTCTCAAATTCTTAATGAG

ACGTTGGATG-AAACTAGCAGAAAGAGGCAG

GTGGGAGGGAGTGCTGA

ACT

rs2853564

ACGTTGGATG-CTGCATTGCTCCTGACTTAG

ACGTTGGATG-AGGTAGCTTAGCTCTGAGTC

TTTCTGCAACCCTAAGCC

ACT

rs731236

ACGTTGGATG-TGTGCCTTCTTCTCTATCCC

ACGTTGGATG-TGTACGTCTGCAGTGTGTTG

CGGTCCTGGATGGCCTC

ACT

rs1544410

ACGTTGGATG-TAGATAAGCAGGGTTCCTGG

ACGTTGGATG-AATGTTGAGCCCAGTTCACG

AGCCTGAGTATTGGGAATG

ACG

rs2239185

ACGTTGGATG-CAATTCCAGTCACATCTCGG

ACGTTGGATG-CCTGTGTGACATTTACACCC

CCCTCCTCTGTCTTCAC

ACT

rs987849

ACGTTGGATG-GAATAGTGCCTTATAGATAG

ACGTTGGATG-AGCTAGAAGTTCTGGTGATC

GAAATATTCGTAATGCTGGAT

ACT

rs1540339

ACGTTGGATG-TCACACACATTCTCAGTGGG

ACGTTGGATG-TTTGCAGAGGCTGTCTTCTC

GTTGGTGCCCACCCTAA

ACG

rs2239186

ACGTTGGATG-GTCCACAGTGACTATAGACC

ACGTTGGATG-AAGAAGGAGAAGCAGGCATC

CAGGGGTGGAAGAAGAGGAG

ACT

rs1989969

ACGTTGGATG-TGTATGCAGAGCTTAGCAGG

ACGTTGGATG-TTTCAGAGGTCAGAGGTGAC

GTCAGAGGTGACATCCAG

ACT

rs2853564

ACGTTGGATG-CTGCATTGCTCCTGACTTAG

ACGTTGGATG-AGGTAGCTTAGCTCTGAGTC

TTTCTGCAACCCTAAGCC

ACT


Wjst BMC Genetics 2005 6:2   doi:10.1186/1471-2156-6-2

Open Data