Table 1

Polymerase chain reaction (PCR) primers used for the amplification of porcine β-defensin genes by RT-PCR
 Gene Accession Nucleotides Primer sequences (5′-3′) A.T.b E.P.c
symbol  number  position (°C) (bp)
pBD105 FP102601.2 20573-25396 F - CTCAATTTACATCAGGGTGC 60 135
R - ACAACCTTCTCGTCCTCAGT
pBD112 CU041392.3 49146-58607 F - TGTGTAGACGGAAGCTTGAG 60 244
R - GTCACATTCTCTCATGCAGC
pBD4a 63852-70272 F - GTGGCTTGGATTTGAGGAGAGAGT 58 232
R - AGTGATACACAGGCCTGGAAGGAT
pBD114 94921-105728 F - ACCTTGGTGGATCCTGAACGATGC 64 128
R - TCAAACGCCCTCTGAATGCAGCA
pBD133 111793-117208 F - GTGCCATGAAAGACACCTAT 60 125
R - CAGACTTCTCCATGCAACAG
pBD108a CU442750.3 1195-6843 F - GACGATTGTCATTCTTCTGATCCTGG 58 258
R - TAGGTTGACTTGTGGTGCCCGAAA
pBD116 21853-26511 F - CTGATCCTGGTTCATAAGAC 60 211
R - GAATCCTCCTTCTCGTTAG
pBD118 75980-87519 F - CTGTTCCTACCACAAGTGAT 60 184
R - GTGCGAGAAGTGACAGTATT
pBD119 89342-101888 F - CTGTTTCTTGCCATCCTT 56 168
R - TACATAGGACTGGAGGCAGC
pBD122 125631-133938 F - GCTGCACTATTGCTCTTGTC 62 158
R - TCACACAGCACAGTTTACCA
pBD123 143565-150992 F - TGGAATCTTCACGGCAAAT 68 100
R - TGATACTTGGGCTTCACACA
pBD124 158778-164429 F - CTTCTGCTTATTGTGGCTCT 56 187
R - ATCTTGGCCATCTTGAGTC
pBD115 CU627978.3 88572-92708 F - CTTAGCTGTCCTTGTGGTCC 64 227
R - CAAGCCTTAGCTGTACTTGC
pBD128 18063-21789 F - GGTTCTCATTATCCTGCTGT 60 258
R - TGTGTTCACTGTGACAGTGG
pBD129 a CU606854.2 119234-124263 F - CAAAGACCACTGTGCCGTGAATGA 58 239
R - TTGATGCTGGCGAAAGGGTTGGTA
pBD3 a F - CTTCCTATCCAGTCTCAGTGTTCTGC 58 308
R - GGCTTCTGTAGACTTCAAGGAGACAT
pBD104 a F - TCCTTCCACGTATGGAGGCTTGTT 58 332
R - TTACAATACCTCCGGCAGCGAGAA

a[19].

b Annealing temperature.

c Expected product size.

Choi et al.

Choi et al. BMC Genetics 2012 13:98   doi:10.1186/1471-2156-13-98

Open Data