Research article
Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods
1 Evolutionary Genetics Group, Department of Genetics, Microbiology, and Toxicology, Stockholm University, Stockholm, S-106 91, Sweden
2 Marine Evolution and Conservation, Centre for Ecological and Evolutionary Studies, University of Groningen, PO Box 11103, 97 CC, Groningen, The Netherlands
3 Provincetown Center for Coastal Studies, 5 Holway Avenue, Provincetown, MA, 02657, USA
4 Section for Evolutionary Genomics, Centre for GeoGenetics, Natural History Museum of Denmark, University of Copenhagen Øster Voldgade 5-7, Copenhagen K 1350, Denmark
BMC Genetics 2012, 13:77 doi:10.1186/1471-2156-13-77
Published: 6 September 2012Additional files
Additional file 1:
Table S1. Reference gene primers tested. BA = Bérubé and Aguilar [38]; CW 2006 = Callicot and Womack [52]; RC 2009 = Cawthon [24]. Note that all reference gene primers used in assays II-IV had a CG-clamp (CGGCGGCGGGCGGCGCGGGCTGGGCGG) attached to increase annealing temperature as described in Cawthon (2009). * Caution; this primer pair was used in assay I in which primer efficiency was found to correlate with DNA concentration.
Format: DOC Size: 46KB Download file
This file can be viewed with: Microsoft Word Viewer
Additional file 2:
Figure S1. Example standard curve for the telomere portion of assay II. In A. it is clear that amplification efficiency decrease in reactions with log DNA above 1.78 (20 ng DNA/reaction) causing deviation from linearity of the standard curve. As illustrated in B. the the linear dynamic range of the telomere primer is within log 1.778-0.347 DNA, corresponding to 60–2.2 ng DNA per reaction. Note how the difference in the slopes of the standard curves in A and B affects the estimated amplification efficiency. In A. the amplification efficiency is E = 2.050 (105.0%) whereas it is E = 1.787 (78.7%) in B. Relationship between and observed “variable” (Ct, N0, fluorescence) against known concentration in a dilution series.
Format: PDF Size: 84KB Download file
This file can be viewed with: Adobe Acrobat Reader
Additional file 3:
Figure S2. Amplification of non template controls (NTC) in the four assays relative to the most diluted standard in the serial dilution series in telomere (A) and reference gene (B). Circles denote the Cq value of individual NTC reactions and bars mark the average Cq and standard deviation of the most diluted standards. Note that the overlap between NTC and standards in the reference gene reactions of multiplex assay II and IV result from telomere-reference gene primer dimers as shown in Supplementary Figure 3A-C.
Format: PDF Size: 9KB Download file
This file can be viewed with: Adobe Acrobat Reader
Additional file 4:
Figure S3. Representative melting curves for the standard and NTC reactions. Black line is the most diluted standard and stippled line the NTC. A: the telomere reaction in assay III where the NTC starts amplifying a few cycles after the most diluted standard. B: the reference gene reaction in assay III where the NTC and standard overlap. C: the multiplex reaction in assay II in which telomere-reference gene primer dimers are producing a peak at approximately 87°C in the NTC but not in the standard.
Format: PDF Size: 127KB Download file
This file can be viewed with: Adobe Acrobat Reader
Additional file 5:
Table S2. Linear regression and correlation between expected log amount DNA in standards and their amplification efficiencies as estimated in LinRegPCR. Bold values are significant at the 5% level. Slope = slope of the regression line; Intercept = intercept of regression line reflecting the hypothetical maximum efficiency in percent.
Format: DOC Size: 35KB Download file
This file can be viewed with: Microsoft Word Viewer
Additional file 6:
Table S3. Percent correlation (R2) between telomere length estimates obtained by different quantitative methods. Pfaffl LR = the Pfaffl method with baseline corrected in LinRegPCR; Ruijter = the Ruijter method; ddCq = the comparative Cq method; Pfaffl RG = the Pfaffl method with baseline corrected in Rotor-Gene or ABI software. See text for details.
Format: DOC Size: 30KB Download file
This file can be viewed with: Microsoft Word Viewer


