Table 5

Primers used for PCR amplifications of candidate genes in P. vulgaris in the Core and wild collections
Gene Primer Name F/R Sequence (5′-3′) Ta (°C) Source Sequence*
Asr1 (region 1) ADOC01_01_Pv_12 F GAGGAGACTAAGCCCATAGA 62 IRD TC2798
ASR_TC2798_RV** R TGGACAGAAGCCATTCACTCCCAA CIAT
Asr2 (region 2) ASR_TC2798_FW2 F AAGCACCACAAGCATCTTGAGCAC 53 CIAT
** R ** **
Asr2 ADOC01_03_Pv_05 F CCACCACCACAAAGAGGA 60 IRD CA910244
ADOC01_03_Pv_06 R CAAACATTCTTCAAACTTGCTCAGA IRD

*Accession ID of the original EST sequences used to design the primers. TC accessions are from Gene Index (compbio.dfci.harvard.edu/tgi/).**The reverse primer ASR_TC2798_RV was also used in this case.

Cortés et al.

Cortés et al. BMC Genetics 2012 13:58   doi:10.1186/1471-2156-13-58

Open Data