Table 5

Primer sequences used for the generation of sugarcane retrotransposons-based markers
Primer Sequence 5′→3a
Short arm oligonucleotide (AS) TGGGATCTATACTT - H2N
Long arm oligonucleotide (LA) ACTCGATTCTCAACCCGAAAGTATAGATCCCA
Adapter primer (AP) ACTCGATTCTCAACCCGAAAG
scIvana1_SSAP1 (sIvSI) CAAGCCCTTAATAGCAGAAA
scIvana1_GagRev (sIvGR) TCCCTGTATACAACCCTGTC
scIvana1_LTR1 (sIvLI) AGTCCTGCTCCCAGTTATCA
scIvana1_LTR2 (sIvLII) GTCGCCTGGGTGTGTTATC
scAle1_LTRr (sAlLr) ATACATGGGCCACATGGG
scAle1_RT (sAlRT) CCTCCCDTCCTCGACCTTC
scAle1_LTR1 (sAlLI) CCATGWGRCTAGGCCCATGTGGC
scAle1_LTR2 (sAlLI) GGGGTGTTGGAGTGTGATTG

a D = A, G or T; R = A or G; W = A or T.

Palhares et al.

Palhares et al. BMC Genetics 2012 13:51   doi:10.1186/1471-2156-13-51

Open Data