Table 1

Primers used for this study
Forward sequence Reverse sequence Tm Size
Nle1 sequencing primers
Nle1E1/2 CTTGACTCCTCCGAACACGAG AAACACAGCCTGTCTGTAGGTGAG 62 500
Nle1E3 GATTAAATTTGTCGCATGGTGGTA GTCTGTTACTTGCAACGTGAGTCC 62 475
Nle1E4 TATTTCTCCTCAGGGAATGGAGAG CCACACTCAGTCCAGTATCTGCTT 62 377
Nle1E5/6 CTGTGTTCTCCCTCACCTCTCC ATAGTAGGCCAAGCCGTTGCT 62 557
Nle1E7 ACAGCCTTGCTCTGCTGTTAGAA GGACCAGCTGGACTCTTGGTATAA 62 440
Nle1E8/9 TTCCTGATTCTTGCCTTATGTCAC AACCCTAACTAAGACAACCAAGAACAA 62 544
Nle1E10 TGGAGTTGCATGTAAGCTTGTGT GTCACTAGCCCTAAAGATGCCATT 62 488
Nle1E11/12 CCGGCCCAGGTACCTAGCTT ACCTACAGGTTCTCCCAGAGTCTCC 62 498
Nle1E13 ACTTGATACTTGGCAGTAGGCACA CTCCTGCTATCCAGTGCAAGG 62 570
Nle1 genotyping primers
Nle1 GSP GCTGTAATGTCCTGACTGT 60 637
cDNA 1 CTGTGTCGTACTCTTCAAGGTCAT CTGTGGAGTCATCTTCTCCATATC
cDNA 2 TCAGACGACTTCACCTTATTCCTG CAGTCAACAGCATATACCTCATCG 62 351
Nle1 DNA TCTCCTTCAGCTCCTTCACTGT TCCAATGGTGGAGTATAGGGTATAA 60 341
cDNA amplification primers
1st PCR ATATGGATCCGGCGCGCCGTCGACT24 ATATCTCGAGGGCGCGCCGGATCCT24 67
2nd PCR (NH2)ATATGGATCCGGCGCGCCGTCGACT24 (NH2)ATATCTCGAGGGCGCGCCGGATCCT24 67
Eed GTGTGACATTTGGTACATGAGGTT ACATTTATGATGGGTCAGTGTTGT 60 148
TaqMan gene expression assay
Assay ID Amplicon Size (bp)
Trp53 Mm01731290_g1 119
Cdkn1a Mm04205640_g1 80
Gapdh Mm99999915_g1 107

Lossie et al.

Lossie et al. BMC Genetics 2012 13:106   doi:10.1186/1471-2156-13-106

Open Data