Table 6

Sequences of primers used in this study
Forward primer code Sequence (5’—3’) Reverse primer code Sequence (5’—3’)
Me01 TGAGTCCAAACCGGATA Em01 GACTGCGTACGAATTAAT
Me02 TGAGTCCAAACCGGAGC Em02 GACTGCGTACGAATTTGC
Me03 TGAGTCCAAACCGGAAT Em03 GACTGCGTACGAATTGAC
Me04 TGAGTCCAAACCGGACC Em04 GACTGCGTACGAATTTGA
Me05 TGAGTCCAAACCGGAAG Em05 GACTGCGTACGAATTAAC
Me06 TGAGTCCAAACCGGTAA Em06 GACTGCGTACGAATTGCA
Me07 TGAGTCCAAACCGGTCC Em07 GACTGCGTACGAATTCAA
Me08 TGAGTCCAAACCGGTGC Em08 GACTGCGTACGAATTCTG
Me09 TGAGTCCAAACCGGACG Em09 GACTGCGTACGAATTCGA
Me10 TGAGTCCAAACCGGACT Em10 GACTGCGTACGAATTCAG
Me11 TGAGTCCAAACCGGAGG Em11 GACTGCGTACGAATTCCA
GBssr-sa-05-F TCATATATAAAAGGAGCCCAAC GBssr-sa-05-R GTCATCGCTTCTCTCTTCTTC
GBssr-sa-08-F GGAGAAATTTTCAGAGAGAAAAA GBssr-sa-08-R ATTGCTCTGCCTACAAATAAAA
Sesame-09-F CCCAACTCTTCGTCTATCTC Sesame-09-R TAGAGGTAATTGTGGGGGA
GBssr-sa-33-F TTTTCCTGAATGGCATAGTT GBssr-sa-33-R GCCCAATTTGTCTATCTCCT
GBssr-sa-72-F GCAGCAGTTCCGTTCTTG GBssr-sa-72-R AGTGCTGAATTTAGTCTGCATAG
GBssr-sa-108-F CCACTCAAAATTTTCACTAAGAA GBssr-sa-108-R TCGTCTTCCTCTCTCCCC
GBssr-sa-123-F GCAAACACATGCATCCCT GBssr-sa-123-R GCCCTGATGATAAAGCCA
GBssr-sa-173-F TTTCTTCCTCGTTGCTCG GBssr-sa-173-R CCTAACCAACCACCCTCC
GBssr-sa-182-F CCATTGAAAACTGCACACAA GBssr-sa-182-R TCCACACACAGAGAGCCC
GBssr-sa-184-F TCTTGCAATGGGGATCAG GBssr-sa-184-R CGAACTATAGATAATCACTTGGAA

Zhang et al.

Zhang et al. BMC Genetics 2012 13:102   doi:10.1186/1471-2156-13-102

Open Data