Table 4

Primer sequences for the bovine ACSL1 gene applied for annotation confirmation, screening for polymorphisms and genotyping

Primer

Sequence (5' → 3')

Gene region

Amplicon (bp)

Position in reference sequence

AccNo. of reference sequence

Application*


ACSL1_F1

ACSL1_R1

CCGAGCCCCAACCGAGAC

TGGACGCTGTTCTTGAGTGGTG

intron 1 -promoter

844

1918181 - 1918198

1919003 - 1919024

NW_001494406.2

SNP

ACSL1_E1_F3

ACSL1_E1SF

GACCCGAGCCCCAACCGAG

GTTGAGCCACCACAATTTACTC

intron 1 -promoter

497

1918178 - 1918196

1918674 - 1918653

NW_001494406.2

SNP

ACSL1_E1SR

ACSL1_R1

GGACTGCCCTGGATTTCACAAG

TGGACGCTGTTCTTGAGTGGTG

promoter

413

1918612 - 1918633

1919003 - 1919024

NW_001494406.2

SNP

ACSL1_F2

ACSL1_R2

TCGCTGCTGAAGTCCTGTCTG

GCTCTAATGCCCCCGTTGATG

exon 2

501

1897290 - 1897310

1897770 - 1897790

NW_001494406.2

SNP

ACSL1_F3

ACSL1_R3

TTGCGTGGGAGAGAGTTGTG

TCAGGTGGAGGATTTATGTCAG

exon 3

384

1882758 - 1882777

1883120 - 1883141

NW_001494406.2

SNP

ACSL1_F4

ACSL1_R4

GCATCCACACTCCATAGAAAC

AATAAAGAAGCAAAACTCAGACC

exon 4

345

1881998 - 1882018

1882320 - 1882342

NW_001494406.2

SNP

ACSL1_F5

ACSL1_R5

ATGAAAGGGAAAAGTGAAAGTG

CTTGAGTTGGACCTGATGCTG

exon 5

457

1878288 - 1878309

1878724 - 1878744

NW_001494406.2

SNP

ACSL1_F6

ACSL1_R6

CGGCTGGAAGTAAAGAGACAC

TTGTGTTCTTCATCCTCCTTTC

exon 6

574

1875840 - 1875860

1876392 - 1876413

NW_001494406.2

SNP

ACSL1_F7

ACSL1_R7

GTTCTCTTTTACAGGACCAG

CAGGGATGCTTTACTTACTC

exon 7

600

1875542 - 1875561

1876122 - 1876141

NW_001494406.2

SNP

ACSL1_F8_9

ACSL1_R8_9

TGGGTGATGTAAATGTGTGAGG

ATGATAGGAATGGCAGTGGAGAC

exons

8-9

750

1872567 - 1872588

1873294 - 1873316

NW_001494406.2

SNP

ACSL1_F10

ACSL1_R10

ATCTGTATTTCAGGTACTGTTTC

GTTTATGGGCTTCTCTCACG

exon 10

287

1871656 - 1871678

1871923 - 1871942

NW_001494406.2

SNP

ACSL1_F11

ACSL1_R11

TACACACTTGAACTTACCAG

TGTGCTCTGAAATAAATGG

exon 11

314

1869171 - 1869190

1869466 - 1869484

NW_001494406.2

SNP

ACSL1_F12

ACSL1_R12

TCTGTATTGTGCCTTCTGATG

GGAAACTGGGCTGAAATGC

exon 12

371

1866801 - 1866821

1867153 - 1867171

NW_001494406.2

SNP

ACSL1_F13

ACSL1_R13

TCTCACACAATAAAGGGGTAGG

TCCACATCTTCACCAACACTC

exon 13

516

1864669 - 1864690

1865164 - 1865184

NW_001494406.2

SNP

ACSL1_F14

ACSL1_R14

AAGCCGCCCAGGAATAACAC

TGCCACAAACCCACGACACT

exon 14

516

1863888 - 1863907

1864384 - 1864403

NW_001494406.2

SNP

ACSL1_F15

ACSL1_R15

GACTTGTGTTTATTTCTGCCTG

TGGGCTGAGGTTTCTAATCC

exon 15

524

1862774 - 1862795

1863278 - 1863297

NW_001494406.2

SNP

ACSL1_F16

ACSL1_R16

TGCTGAGAAGTGGCTGGTTAC

CATGAGAACAGGGCTTATTGG

exon 16

247

1860135 - 1860155

1860361 - 1860381

NW_001494406.2

SNP

ACSL1_F17

ACSL1_R17

ATGCGAGGGAGAAAGAGG

CCGCTAACAAAAAGAACAGTG

exon 17

427

1859039 - 1859056

1859445 - 1859465

NW_001494406.2

SNP

ACSL1_F18

ACSL1_R18

GGCAAACTTCCCATTACACTG

GACTCCTTCATCCCTTCTCTG

exon 18

512

1857386 - 1857406

1857877 - 1857897

NW_001494406.2

SNP

ACSL1_F19_20

ACSL1_R19_20

GCCAAAGCACACCACTCTC

CGAAGCAGATAATAAGGAACTAC

exons 19-20

517

139425 - 139443

139919 - 139941

NW_930554.1

SNP

ACSL1_F21

ACSL1_R21

CACCCGCCTTTGTAACTG

GTCCTGATTCTGTCCTGATGTC

exon 21

548

138819 - 138836

139345 - 139366

NW_930554.1

SNP

ACSL1_UTR_F31

ACSL1_UTR_R3

AAACCCTCTGGTCCTCTTGCG

CAATGGCAGGAAGGGAGGGAG

exon 21

404

138633 - 138653

139016 - 139036

NW_930554.1

SNP

ACSL1_UTR_F2

ACSL1_UTR_R21

GAGTTTTCCAGATTCCTATGTCC

CCTGTTACCCTCCCTTCCCTG

exon 21

650

137966 - 137988

138595 - 138615

NW_930554.1

SNP

ACSL1_UTR_F11

ACSL1_UTR_R1

ATGCGACTGCTGACATGAAAAAC

AAATAAATGCTCTTCTGTCGTAATG

exon 21

527

137530 - 137552

138032 - 138056

NW_930554.1

SNP

ACSL1_E1_F3

ACSL1_E1_R2

GACCCGAGCCCCAACCGAG

GCTCGTAGGCTGCAGCGAG

intron 1-promoter

220

1918178 - 1918196

1918379 - 1918397

NW_001494406.2

GT

ACSL1_F7

ACSL1_R7

GTTCTCTTTTACAGGACCAG

CAGGGATGCTTTACTTACTC

exon 7

600

1875542 - 1875561

1876122 - 1876141

NW_001494406.2

GT

(PCR-RFLP)

ACSL1_E1_F5

ACSL1_E1_R3

ACSL1_E1_F7_T

ACSL1_E1_R8_C

GGAGGGAACTCGGGGAGCC

AGGGCGGGGCTGAGACGG

GCTATTTAAGGGTGCCGCCGT

GCAGCCAGCTCTCGGAAGTAG

promoter

451

316

175

1918052 - 1918070

1918485 - 1918502

1918328 - 1918348

1918348 - 1918368

NW_001494406.2

GT

(Tetra-ARMS PCR)

ACSL1_E1_F2

ACSL1_E5_R1

CGGAGGAGACTGTGGCTTAG

CTGAGCGAAGATGCCAATAAAC

exons

1-5

505

38 - 58

521 - 543

NM_001076085.1

cDNA

ACSL1_E5_F1

ACSL1_E12_R2

CAGTTTATTGGCATCTTCGCTC

GGAAGATGGTGGGTTGAAGG

exons

5-12

649

519 - 541

1148 - 1168

NM_001076085.1

cDNA

ACSL1_E11_F2

ACSL1_E18_R1

CCATATGTTTGAGAGAGTTGTAG

ATGTACTCCCCCTGTGCCAG

exons 11-18

735

1046-1069

1761 - 1781

NM_001076085.1

cDNA

ACSL1_E17_F2

ACSL1_E21_R2

CTGGATAAAGACGGCTGGTTG

GAGTTCAGGGTGGAGATAGATG

exons 17-21

399

1665 - 1686

2042 - 2064

NM_001076085.1

cDNA

ACSL1_E21_R3

GTCAAACTCCCCTCCGCTTC

exons 17-21

540

2185 - 2205

NM_001076085.1

cDNA, RT

ACSL1_E21_R4

CAGAAAGAGCAAAGTCCTAACC

2454 - 2476

NM_001076085.1

cDNA, RT


* cDNA: analysis of cDNA structure, RT: reverse transcription, GT: genotyping, SNP: screening for polymorphisms

Widmann et al. BMC Genetics 2011 12:96   doi:10.1186/1471-2156-12-96

Open Data