Table 3 |
|||
|
List of primer sequences used for typing MUC4 polymorphisms and quantitative PCR |
|||
|
Application |
SNP/Gene |
Primer Sequence (5' →3') |
Length (bp) |
|
|
|||
|
Pyrosequencing PCR |
DQ124298:g.243A>G |
F: *tggtgctacccccagatttg |
|
|
R: gttgtgtccaccccttacccttat |
195 |
||
|
P: gtcccctctcccaggta |
|||
|
|
|||
|
DQ124298:g.344A>G |
F: *gtggccctcagtcactagagt |
||
|
R: cgaagttgtgaaaggaagacag |
258 |
||
|
P: ttggggttggggcag |
|||
|
|
|||
|
qPCR |
MUC4 |
F: atgggcttctccagtggagat |
66 |
|
R: tctcccacactggctgcaa |
|||
|
|
|||
|
* 5' Biotin labelled, F forward primer, R reverse primer, P pyrosequencing primer |
|||
|
Balcells et al. BMC Genetics 2011 12:93 doi:10.1186/1471-2156-12-93 |
|||
