Table 3

List of primer sequences used for typing MUC4 polymorphisms and quantitative PCR

Application

SNP/Gene

Primer Sequence (5' →3')

Length (bp)


Pyrosequencing PCR

DQ124298:g.243A>G

F: *tggtgctacccccagatttg

R: gttgtgtccaccccttacccttat

195

P: gtcccctctcccaggta


DQ124298:g.344A>G

F: *gtggccctcagtcactagagt

R: cgaagttgtgaaaggaagacag

258

P: ttggggttggggcag


qPCR

MUC4

F: atgggcttctccagtggagat

66

R: tctcccacactggctgcaa


* 5' Biotin labelled, F forward primer, R reverse primer, P pyrosequencing primer

Balcells et al. BMC Genetics 2011 12:93   doi:10.1186/1471-2156-12-93

Open Data