Table 1

PCR primers used to amplify rat Edaradd cDNA

Primer set

Forward (5' > 3')

Reverse (5' > 3')


Edaradd-1&2

CTGAGAGAGAGTCGCGCATT

GCCACAGCTGTTCCCATAG

Edaradd-3&4

GCCCAGAAAAGGCAGCTC

GGAAAACCTTTGGAGTTTCTGA

Edaradd-5&6

CGATGAGCCAGCTTTACCTC

GGATAATTGGGTAACTATTCTCAACC

Edaradd-7&8

TCCATCCCAATTTTACCAACA

CGGCAAGCATTTTAATGACC

Edaradd-9&10

CAGTCAGCCCCTTGCACT

GCATGCTCTCATCAACATGG

Edaradd-11&12

TGTCACCAATGTGGTAGAAAAA

CAGGGATAACCACTGCCTGT


Kuramoto et al. BMC Genetics 2011 12:91   doi:10.1186/1471-2156-12-91

Open Data