Table 6

Details of microsatellite loci genotyped in H. erato and H. melpomene.

Ta (oC)

Locus

Primer sequence (5'-3')

Core repeat

GenBank number

H. erato

H. melpomene

Ref.


Hel02

F: TCAAAATGTTGCAGACCGAG

(GA)13(GAAA)2(GA)2

AF481467

55

-

[59]

R: TGCACTTCATTGTAAGGCGT

Hel05

F: TGCTGTCCATACCCAACTCA

(GA)14CA(GA)4

AF481470

52

55

[59]

R: CGAACTCACAACCATCAGTCA

Hel10

F: TCTCACTTTCCCACACAGCA

(CA)7TA(CA)10

AF481475

55

-

[59]

R: TGTGAAGAGACACATGGGGA

Hel11

F: TTTCTTTTGAGTCCCGATGG

(CA)12

AF481476

55

55

[59]

R: ATCTCAGAACTGGTCGGCAG

Hel12

F: CGGCACTTCATGTTTCATTT

(TAG)4

AF481477

55

-

[59]

R: GGCATTTGACTTCAGAATGG

Hel13

F: ATTTCATAGTAACGCCCTCC

(CA)13

AF481478

55

-

[59]

R: TGACTTATCGCTAAGGTCAA

Hm06

F: AAATAGTGTGCGGCGGAATA

(CA)7

DQ020077

55

-

[60]

R: TGGAGTAGAAATGCGGGTTTA

Hm08

F: AAAGCCTGAGTGCCGTATTG

(CA)17

DQ020079

-

55

[60]

R: GCAATGTCAGCATCGAATGT

Hm16

F: CGGATAGACATTTGTTAAAGTGTG

(CA)14

DQ020086

-

55

[60]

R: ACGAGGATGCGGACTACG

Hm22

F: CCTCGTCCAAACTCCAAAAC

(GA)16

DQ020090

-

52

[60]

R: AACAATGTCACAACCATCGC


Albuquerque de Moura et al. BMC Genetics 2011 12:9   doi:10.1186/1471-2156-12-9

Open Data