Table 5

Linkage map end-markers used in genome coverage estimation, their BAC clones and overgo sequences, probe colours, cM and percentage coverage of the chromosome.

Chr

End marker

BAC clone

Overgo sequences

Probe colour (Fig. 1)

cM length

covered by

end markers

FISH-mapped

in Fig. 2

% of chr included

chr length (cM)

m%c

n%d


KJW105

MeVIA_123J11

NAa

Green

321.2

93.76

342.6

3.51

2.73


1

Y148

MeKba_448F6

a: CCAAACTGTAATGAAGGTTCAATG

b: GCAGGTTACTTAGCTACATTGAAC

Red


2

MeVIA3N11-345

MeVIA_3N11

NA

Green

138.9

56.24

247.0

18.21

25.55


MeKba206L23-25864

MeKba_206L23

NA

Red


3

DNHD2

MeKba_175F3

NA

Green

230.5

95.09

242.4

3.18

1.73


G16-2

MeKba_323D15

a: GAGTTCAAATCCAGTCTCTCTTAC

b: CAGGGTTGCATAGTGAGTAAGAGA

Red


4

MeVIA2J14-517

MeVIA_2J14

NA

Green

165.2

88.93

185.8

9.89

1.18


PA55

MeKba_369C8

a: TCTACAAAATGAGGATAATACTCC

b: GAACCCCTGTGAAGTAGGAGTATT

Red


5

PTCHD1

MeKba_555M23

NA

Green

200.2

86.04

232.7

1.89

12.16


T31-1

MeKba_345M2

a: CTGGGATTCTAAGAGGGTGAGAAG

b: TCCCCAAATCCTGGTTCTTCTCAC

Red


6

MeVIA2P1-275

MeVIA_2P1

NA

Green

129.6

96.58

134.2

2.72

0.69


C2orf54

MeKba_307P14

Na

Red


7

G31-1

MeKba_80D8

a: TATTTCCCTAGGGAGGGACATCTG

b: AGGAAGATGGTGCTTGCAGATGTC

Green

107.9

87.17

123.8

1.38

11.45


KJW220

MeVIA_115N20

NA

Red


X

KJW281

MeVIA_15A6

NA

Green

88.1

25.84 (46.43b)

189.7b

70.36

3.81


MeKba494M2-50126

MeKba_494M2

NA

Red


TOTALS

1381.6

1698.2


The final column shows the estimated full chromosome lengths, calculated from the previous two columns.

a NA = not available, as no overgo probes were designed for this marker.

b The value 46.43 is the estimated % coverage of Xq and 189.7 is the estimated cM size of Xq, as the 25.84% physical size coverage of MEUX may not reflect the linkage length coverage because of a relative large nucleolus organiser region (NOR) on Xp.

c m% = the percentage of the length of the p arm not covered by the linkage map, for a particular chromosome.

d n% = the percentage of the length of the q arm not covered by the linkage map, for a particular chromosome.

Wang et al. BMC Genetics 2011 12:72   doi:10.1186/1471-2156-12-72

Open Data