Table 2

Set 2 markers: chromosome location and primer sequences

Marker Namea

Physical location (ChrArmBand)

Informative meioses

MgCl2 (mM)

Primer sequences


M

F


MeKba170K8-13193

2q2

77

102

2.5

F: CATACCTTCTCTTGTCTTGTGGC

R: TTCATATTGGAGGAGGATTAGC

MeKba175L17-104075

3q2

93

121

1.5

F: CCATCACATACCACACACGC

R: TTGGCTATAATTGTGGTCAGC

MeKba182A19-136367

3q2

95

81

1.5

F: TGTTAATGTATCATCATCACTCTCC

R: GAAGGAACAATGACAGAACTTAGC

MeKba191O7-75495

1q3

82

85

2.5

F: TATGCATCGAGTGCCTGC

R: AGCCTTCCTTGCCATTAACC

MeKba206L23-25864

2q3

84

111

1.5

F: GCCGTGAGCACTCTGTCC

R: CCATCCTCAATCTCCTCTCC

MeKba273F23-57082

1q2.2 (1q5)b

80

88

2.5

F: GTGCCACTGTAGTCCACCTG

R: CTGGTTCTGGTCTCTGGAGC

MeKba281G14-77691

6q3 (1q3-4)b

51

123

1.5

F: ATCGACAGCCTCTCCAACC

R: GGCAATGAGATGAGATGTGC

MeKba282N22-44716

1q4-5

95

107

2.5

F: GGTCAGACACGCACAACC

R: CAGAATTGGCACCTAGATATTCC

MeKba337B13-128470

2q3

68

75

1.5

F: TTAATGAATTCCAATGGCTACC

R: GAGTACATTCCAGGCATAGTGG

MeKba389E8-21049

2q2

72

86

2.5

F: ATCTAATGATAGCCACCTCTGG

R: TGACTGACAACTTAGCCTGCC

Mekba458L18-116052

2q3

81

117

1.5

F: CTCTGGCTCAGGTCCTTCC

R: TCTATTCTCCTGTGATCCTATGC

MeKba472N21-102181

3q1

89

84

1.5

F: AGGAGGACTGGAGGAATTAGG

R: GAGAAGTGAGCCTGGACAGC

MeKba494M2-50126

Xq3

0

91

2.5

F: GTCGCACAGCTGGTTAAGG

R: GCATTCTTATTGGAACTGTGACC

MeKba510M2-126695

Xq2

0

71

2.5

F: ACCACACAGACACATGCACC

R: GAATAGTCCACCACCACTCTAGG

MeKba510M2-pseudoc

NAd

61

88

2.5

F: ACCACACAGACACATGCACC

R: GAATAGTCCACCACCACTCTAGG

MeKba526C2-33878

1q5

85

125

1.5

F: GGTTGCATTCACTGGTCTAGG

R: GGTTGCATTCACTGGTCTAGG

MeKba528O13-122762

3q2.3

0e

27

2.5

F: CACTGTGCTATCTGCTGAAGG

R: GATGGCGTGGTCTTCTTAGG

MeKba598C23-22378

Xq2

0

99

1.5

F: CCATTGCTACTACCTTCAGCC

R: GGTGAGGTGATATTCTGTCTTGG

MeKba60J17-8783

3q2.3

93

107

2.5

F: ACATTCTTGCCAGGCTCACC

R: AGTGGAGGCATCTCAAGGC

MeVIA121C8-17366

Xq3

0

83

1.5

F: TTTCTCAGCCACACCTCTCC

R: ATATGCCCCAAAAGGAGCAC

MeVIA1A16-106

2q5

1e

42

2.5

F: AGCTCATTGTGAGAACTCGG

R: TGTAAGTTAGCATGGTGAAGAGC

MeVIA1B23-391

4q2.3

89

107

2.5

F: TGAAGGCTTGACTTCCTTCC

R: TTCATCATGTCTGTAGCCTTAGC

MeVIA1B5-253

4p2.1

91

106

2.5

F: CAGTTACCTGGTGATGACTTGC

R: GGAATTAGCTGTTCAGGAATAATTAGG

MeVIA1G15-185

5q1

97

105

2.5

F: CCGCCTATCCTCAATAACTGC

R: GAATAACAACAGACACACACACG

MeVIA1G3-226

1q1 (7p3)b

61

100

2.5

F: TCTTCACATTAGAGAACAGAACAGG

R: GACACCTCTGCTCCACACC

MeVIA125B16-39822

NAd

92

110

1.5

F: CTCTTCCCCACTCCCCTATC

R: CCCATGGATTGGAGGATTAC

MeVIA1L6-488

1q3

99

123

1.5

F: ATTCATCCATCCATCCATCC

R: AAGGTTGTTAAGTGGCAGAGC

MeVIA2C3-167

3q

56

91

2.5

F: CATGCCAACTCTCTATGTATTGG

R: CAGATGAGGTATGGTCAACAGG

MeVIA2J14-517

4p3.3

43

93

1.5

F: GAGGATGGTGATGAAGCAGG

R: TTAAGAAGGAAGATAGGCTCAGG

MeVIA2J8-594

1p1

16e

19

2.5

F: AACTTGGATAACTGGAAGAATGC

R: GATGCCAATTAATCTGTGTTCC

MeVIA2M13-303

3q2-3 (1q3)b

73

115

2.5

F: GCGTACTACACAAGAAGGTGC

R: GGTGTTACAGAATGTGCATAGG

MeVIA2M6-313

3q3 (5q1-2)b

87

107

2

F: AATCAACATGGTTCTTATTGTTCC

R: CTCAAGGCGATGCTTATTCC

MeVIA2O13-302

1q3

74

123

2.5

F: GCGTACTACACAAGAAGGTGC

R: GGTGTTACAGAATGTGCATAGG

MeVIA2P1-275

6p3

51

61

2.5

F: CATATGATAGAATAGGATGATTGGC

R: TGTGACCAATAAGACCAGATAGG

MeVIA3B3-434

4p2.1

71

85

1.5

F: TTCATACAATTCCTCCATGCC

R: AGAAGTTCAAGGTCACACAGC

MeVIA3C10-475

1q5

77

89

2.5

F: AAGTTAACAGAAGCAGACCTTGG

R: AGTTCCATTCCAGCTTCACG

MeVIA3F20-234_LOWER

NAd

87

103

2.5

The same as MeVIA3F20-234_UPPER

MeVIA3F20-234_UPPER

2q2

90

92

2.5

F: CCTAGAAGAATCTGTTGCTGACC

R: GCCTTATCTGTTGCAGAATCC

MeVIA3G11-104

7p3

75

117

2.5

F: TTAAGCATTAAGATTACATACATCTGC

R: ATGGCGTGGTCTTCTTCC

MeVIA3G15-373

4q2 (1q2)b

63

67

1.5

F: TGAGAATGTCTCCTTCATGGC

R: AATCCATAGTCTCTCTCTTGAGTCC

MeVIA3H17-399

3q2

79

80

2.5

F: CCATGTTATCTCCTGTCAATGC

R: GTCACGAGCCAACTTCAGC

MeVIA3H22-576

1q4

63

63

2.5

F: GACCACATACAGAGAAGTACCTATGG

R: CAGACTAAGTGCCATCTTCTGC

MeVIA3I8-498

4q1.1

94

122

1.5

F: GGCACATTCTCACCTCTACC

R: TCTATGAGACCAAGAGCTTAATCC

MeVIA3L16-78

6q2-3

92

111

1.5

F: TAATCCATAAGGCCAGCTCC

R: CATACAACTCATCAAGCTTCACC

MeVIA3M11-142

1q4-5 (2q3)b

91

99

1.5

F: TCTGATCACAGTGTCTCCTGC

R: TTGTTGGTCATCGTATCTTCC

MeVIA3M4-293

3q3

89

87

2

F: ACATTCCAGCTTCTTCTGCC

R: CCTCACACACACATATACATACACC

MeVIA3N11-345

2q1

93

118

2.5

F: TCGAGTCAGTATCACCAGCG

R: TTAATACCTCCTCCATGCTCC


a Set 2 markers are named as "BACName-Location", e.g. MeVIA3N11-344 is a marker within MeVIA BAC library clone 3N11, starting at base 344; while MeKba389E8-21049 is a marker within MeKba BAC library clone 389E8, starting at base 21049. In one case (BAC MeVIA3F20-234), two groups of PCR products were obtained from the single pair of primers, and each group was treated as a separate marker, named MeVIA3F20-234_UPPER and MeVIA3F20-234_LOWER.

b The FISH-mapping locations of these markers are different from their linkage map locations (which are presented in brackets). Because of this conflict, these markers were not included in the final linkage map.

c Secondary anonymous microsatellite locus that is co-amplified using these primers, and possibly could be a HPRT pseudogene.

d NA = not available

e Meiosis number less than 19, and not included in the map construction.

Wang et al. BMC Genetics 2011 12:72   doi:10.1186/1471-2156-12-72

Open Data