Table 1

Set 1 markers: BAC clone, chromosome location and primer sequences

Marker Namea

BAC clone

Chr

Arm

Band

Informative meioses

MgCl2 (mM)

Primer sequences


M

F


KJW105

MeVIA123J11

1

p

2

3d

64

1.5

F: TAAAAGCGCTGGGTGATTTC

R: GGTTATCACATTTGGAAACAAAGC

KJW117

MeVIA72C1

X

q

3

0

89

1.5

F: AAGAGGTGAGTTGGGACACG

R: TGGCCTGGGATTAAAAGTCA

KJW122

MeVIA78K19

1

q

3

61

106

1.5

F: GCAGCTTCAGAAATGCAAAC

R: GGTTCTGCAAACTCCAGTGAG

KJW174b

NAc

NAc

NAc

NAc

97

89

2.5

F: ACGTGTATGTGTAAGTGTGTATGT

R: CCTGGCACCTAGATAAAGCA

KJW175

MeVIAP6

7

p

3

94

122

1.5

F: CACAGAAACTTGGGGAAAGC

R: TCTTCCTGATGGGATGAAGG

KJW186

MeVIA49J18

2

q

1

93

115

1.5

F: GCTTTTTCAAAGGGACATTTTC

R: CGCACTCTTTCAAGGGACTG

KJW192

MeVIA142H21

5

q

2

45

94

1.5

F: ATGGGGAAACTGAGGCAGAG

R: AGTTGGAACCACCTCCACTG

KJW208b

NAc

NAc

NAc

NAc

89

104

1.5

F: ACTGAGACAATGCCTTTCC

R: TTCCTGCCTTCTTTACTCC

KJW220

MeVIA115N20

7

q

3

7d

58

1.5

F: TATCTCATGGGGAGGAGGTG

R: CCAGGTCAAACACAGTGAGC

KJW221

MeVIAP6

7

p

3

94

125

1.5

F: CAGCAGAAGAGGGGAGACTG

R: CACAGAAACTTGGGGAAAGC

KJW243

MeVIA35G12

X

q

2

0

102

1.5

F: ATTGGTGAATGGCAAATGAG

R: CCTTCTTCCTTTGTCCTGATG

KJW258

MeVIAE9

5

p

2

90

110

1.5

F: TGTGAGGCAAAGAAATTCCAG

R: ATCAGCCCTGGGGATAGATG

KJW281

MeVIA15A6

X

q

2

0

100

2.5

F: GACCAGGTTGTTGGGTCAAG

R: CATTCAGGACAGGTAGGTAGGG

KJW285b

NAc

NAc

NAc

NAc

100

118

1.5

F: ATCCAAGATGATGGCCTGAG

R: AGAGAGCTCGGTGGCATTAC


a Set 1 marker names comprise "KJW" followed by an identification number, e.g. KJW174.

b These three markers could not be located on any of the 44 BACs. This may reflect failure to optimize the PCR to a working condition in the BAC, or an error in identifying BAC clone during FISH-mapping BACs or screening for AC repeats.

c NA = not available

d Meiosis number less than 19, and not included in the map construction.

Wang et al. BMC Genetics 2011 12:72   doi:10.1186/1471-2156-12-72

Open Data