Table 1

Oligonucleotides

Oligonucleotide combination

Oligonucleotide forward (5'-3')

Oligonucleotide reverse (5'-3')

Size (bp)


1: Intron 3

AGCGTCTTCAGAAGCAGAAC

CCACATCAGCTCTCCTACAG

350


2: Intron 4

CTACGACAGCAAGCTGGTGGACTT

GGTCAAGCCGTTCCATGAGTTCAC

600-700


3: Intron 5

CTCCCCAGTGTAACATGATCAACGG

CAGATTGTCTGCAGGGACAGAAGC

600


4: Intron 10

GGGAAGATCTCAGAGGTTGT

TACACCATCACCATTGGCAA

500


5: Exon 4 and 5

CTACGACAGCAAGCTGGTGGACTT

GATGTCATCTTCGCCGGTATGGATT

138


6: cDNA

CGTTGGACCAATCATTATCGACA

TCTGTAGTGTAGTAGTACAGCTCCCAGAG

1308


7: cDNA

ATGAATAAATCTAAATTAGCGATCGGA

TGTCATCTTCGCCGGTATGGATT

672


8: cDNA

TGATGGAGAACTTGCCGTTCC

CCCTGCAGCACTGGGCTAGACT

1054


Oligonucleotides used for PCR-amplification, QTL-mapping and real-time PCR of the two SCARB1 paralogs in Atlantic salmon.

Sundvold et al. BMC Genetics 2011 12:52   doi:10.1186/1471-2156-12-52

Open Data