Table 1

Bituminaria bituminosa simple sequence repeat (Bbit-SSR) primer pairs selected for characterisation of B. bituminosa germplasm

Marker name

Forward primer sequence

Reverse primer sequence


Bbit-SSR004

ACCACCCGCAGTTACTTTCACCT

CCTTGTGCTGGTTTCACGCAACG


Bbit-SSR005

ACCAAGTCAGGCTGGAACCCCA

GTCCTGGCCCACTGAACGCC


Bbit-SSR008

CATTGACATCCCTAAGCATAATGT

TCGTTAATAGCGGTCTTGGG


Bbit-SSR010

GCAGGCTTTCCTGAACTGAC

GTCTCCACCAGCAATACCGT


Bbit-SSR012

TCATCCCTTCTCTTCCTACTCG

CGGTTTCTTCGAATACACAGTA


Bbit-SSR013

GAAGGCAAGTGAAAAGCCAG

TCAGACACCAGTGGCTCAAC


Bbit-SSR015

GACTGCACGGTCTTCTCGAC

ATGTGCAGAGGCATTTGTTG


Bbit-SSR034

CAATCCCATTTTCCGCTTTA

TGCCCTCTTCCTTCATAGGTT


Bbit-SSR035

ATATCCACCACCTTCCGTGA

GTAGGATAGGGTCCGGTGGT


Bbit-SSR040

TAACCACTTGGAACTGGGGT

AATTGCAACAGCAGCAACAG


Bbit-SSR055

AGCATCACTACGACCATCCC

GGTGACAACAGAGTGGTCTGA


Bbit-SSR056

TCATCCCTTCTCTTCCTACTCG

CGGTTTCTTCGAATACACAGTA


Bbit-SSR059

CATTGACATCCCTAAGCATAATGT

TCGTTAATAGCGGTCTTGGG


Bbit-SSR064

TTGCTTCTGCGTAACTGTGG

AAAAGTCCACGTCAGCATCC


Bbit-SSR066

GGTCGTCCCATTTATCGAAG

GGAAGAACGGTCAATGGAGA


Bbit-SSR067

TCACCTTCCTCACAAACTACCA

TGAAATGCCTCAATGAGCTAAA


Bbit-SSR070

TGTCGAACTGTTGGATTGTGA

AATTGCAACAGCAGCAACAG


Bbit-SSR073

TTTGCTTGTGTCCTGTCCAA

CCTTCCCTTACCCACCAAGT


Bbit-SSR076

AGAAGGCAAGTGAAAAGCCA

TCAGACACCAGTGGCTCAAC


Bbit-SSR079

GAGCTTCGGAGGGAGTTCTT

CCAAAATCCATCACCTTCCA


Bbit-SSR090

CCCTAACATTGGTAACAGCCA

GAGGCTGGCATCAAGTCAAC


Pazos-Navarro et al. BMC Genetics 2011 12:104   doi:10.1186/1471-2156-12-104

Open Data