Table 1

SNP identified in LAP3, LCORL, and NCAPG genes in crossbred steers.

Gene 1

Marker Name2

Accession Number

dbSTS _Id

ss #

SNP3

Position in Gene4

Location on BTA65

For Primer Name

For Primer Seq

Rev Primer Name

Rev Primer Seq


LAP3

79140_312

GF102128

1233209

196003657

INDEL

p.E47del

37964162

LAP3-EX2F

GCCTTGTTCTTTTGTCCTTGAG

LAP3-EX2R

TTGGGTTGAAGTAGCCTGATTT

LAP3

79144_139

GF102139

1233220

196003658

S

p.D92E

37966065

LAP3-EX4F

ACCAAATTTCTTGGGGAGTTTT

LAP3-EX4R

AACACTGCAAGAGGGAACAAAT

LAP3

79146_218

GF102161

1233242

196003659

Y

c.504C>T

37967629

LAP3-EX5F

GGGAAGAAGTGAAAGCTCAGAA

LAP3-EX5R

AAACTGACTAGGGCCATGAGAG

LAP3

79150_94

GF102129

1233210

196003660

Y

c.834C>T

37971945

LAP3-EX7F

CATTTTTCATTTCCTGCCTTGT

LAP3-EX7R

GTAAGCAAAGGGAAGACAGCAT

LAP3

79152_265

GF102108

1233189

196003661

Y

37977863

LAP3-EX8F

TGGAAATTTCTTGGTGCTTGTA

LAP3-EX8R

CTGACTGCTAACCACATTTTGC

LAP3

79154_194

GF102068

1233149

196003662

Y

37979109

LAP3-EX9F

CACACTCCATGTTCCTTCATGT

LAP3-EX9R

TGCAGGACTTGTTTTCTTCTCA

LAP3

79154_347

GF102068

1233149

196003663

S

37979262

LAP3-EX9F

CACACTCCATGTTCCTTCATGT

LAP3-EX9R

TGCAGGACTTGTTTTCTTCTCA

LAP3

79158_103

GF102082

1233163

196003664

S

37984197

LAP3-EX11F

AGGATTTGCCAACATCATCTTT

LAP3-EX11R

CCATGCCTTCTTTTACAAAGCTA

LAP3

79158_104

GF102082

1233163

196003665

R

37984198

LAP3-EX11F

AGGATTTGCCAACATCATCTTT

LAP3-EX11R

CCATGCCTTCTTTTACAAAGCTA

LAP3

79160_105

GF102096

1233177

196003666

Y

37985986

LAP3-EX12F

ATTTCAGCAAATGCCCTACAAT

LAP3-EX12R

TTGAAAATGCAAAAACCAGTTG

LAP3

79162_241

GF102069

1233150

196003667

K

c.*1641T>G

37986804

LAP3-EX13F

TGGGGTTAGATGTTGATTTTTG

LAP3-EX13R

GTGAATATGAGAGCCACACCAG

LAP3

79162_246

GF102069

1233150

196003668

Y

c.*1646C>T

37986809

LAP3-EX13F

TGGGGTTAGATGTTGATTTTTG

LAP3-EX13R

GTGAATATGAGAGCCACACCAG

LAP3

79162_438

GF102069

1233150

196003669

R

c.*1838A>G

37987001

LAP3-EX13F

TGGGGTTAGATGTTGATTTTTG

LAP3-EX13R

GTGAATATGAGAGCCACACCAG


NCAPG

83704_234

GF110810

1241907

263198259

R

38157198

NCAPG-EX4-F

TCTGTCCTTTTCAAGGGATGTT

NCAPG-EX4-R

CAGCCACACAATAATGCGATAG

NCAPG

83704_335

GF110810

1241907

263198262

S

38157299

NCAPG-EX4-F

TCTGTCCTTTTCAAGGGATGTT

NCAPG-EX4-R

CAGCCACACAATAATGCGATAG

NCAPG

83704_358

GF110810

1241907

263198260

W

38157322

NCAPG-EX4-F

TCTGTCCTTTTCAAGGGATGTT

NCAPG-EX4-R

CAGCCACACAATAATGCGATAG

NCAPG

83704_366

GF110810

1241907

263198261

R

38157330

NCAPG-EX4-F

TCTGTCCTTTTCAAGGGATGTT

NCAPG-EX4-R

CAGCCACACAATAATGCGATAG

NCAPG

83708_361

GF110811

1241908

263198263

Y

38158932

NCAPG-EX6-F

GATGGAAGCTAGAGGGGAACTT

NCAPG-EX6-R

CTTTTCATGGTAGGCCTAATGC

NCAPG

83712_168

GF110812

1241909

263198264

R

c.1261A>G

38163729

NCAPG-EX8-F

TTCTCACTTAATGGGGAGCTGT

NCAPG-EX8-R

AAATTTTAAGCAAAAACCTGCAA

NCAPG

83712_422

GF110812

1241909

263198265

R

38163983

NCAPG-EX8-F

TTCTCACTTAATGGGGAGCTGT

NCAPG-EX8-R

AAATTTTAAGCAAAAACCTGCAA

NCAPG

83714_209

GF110813

1241910

263198266

M

c.1357A>C

38164388

NCAPG-EX9-F

TTTCAGAATGTGAATTTTGGCTTA

NCAPG-EX9-R

GTGTGAAAGGGACTGGGTTTTA

NCAPG

83714_224

GF110813

1241910

263198267

K

p.I442M

38164403

NCAPG-EX9-F

TTTCAGAATGTGAATTTTGGCTTA

NCAPG-EX9-R

GTGTGAAAGGGACTGGGTTTTA

NCAPG

83724_658

GF110818

1241915

263198273

Y

c.2158T>C

38180790

NCAPG-EX14-F

ATTTACTTTTGGTGGGGGATGT

NCAPG-EX14-R

CAACCTCCCAATAGTCATTTCA

NCAPG

83726_315

GF110815

1241912

263198269

R

38192653

NCAPG-EX15-F

ATGTAAGGCCTAAAAGGGAGGT

NCAPG-EX15-R

GGAAAGAGCCAAATAATTCAGG

NCAPG

83730_778

GF110816

1241913

263198270

M

p.L877M

38195339

NCAPG-EX17-F

GAGCGTGAATGGTTCAGTACAC

NCAPG-EX17-R

ACTTCAAGAAATGAGCACCAAA

NCAPG

83732_316

GF110819

1241916

263198271

R

38195743

NCAPG-EX18-F

AGTATTTGGTGCTCATTTCTTGA

NCAPG-EX18-R

TCCCAAGTGAATTTAATTAGAAAAA


LCORL

79205_443

GF102113

1233194

196003679

R

38233294

LOC540095-EX6F

CCTATGTAGTGCCTTCCCAGTC

LOC540095-EX6R

CTCGTCCTGCTTCTTAGTTTGT

LCORL

81441_243

GF102084

1233165

196003694

Y

38255270

LOC540095-IN4.4F

GCATGAATGACAAAACTGTGCT

LOC540095-IN4.4R

CATTTTGCCCTTAAGCCTTCTA

LCORL

81439_210

GF102101

1233182

196003693

R

38257174

LOC540095-IN4.3F

TTTGCCTTCAGTTCTCTTAGGC

LOC540095-IN4.3R

TTGCAAAATTATGGCATTTCAC

LCORL

81435_188

GF102143

1233224

196003692

Y

38284737

LOC540095-IN4.1F

TAGCCTGACTGCATCCATCTAA

LOC540095-IN4.1R

GGAAATCCCTGGTTAAGAATCC

LCORL

79197_655

GF110814

1241911

263198268

R

38327100

LOC540095-EX2F

TCTCACGTAGAGTGTATGGATAAGC

LOC540095-EX2R

GAGTTCCAGGCTGCCTATATCA

LCORL

81433_176

GF110817

1241914

263198272

Y

38314844

LOC540095-IN3.1F

GCAGGTGAAAATCCCAATACAC

LOC540095-IN3.1R

GGGCCAAACTAGCCTTATTTCT

LCORL

81419_461

GF102100

1233181

196003691

M

38342145

LOC540095-IN1.9F

GACTTCAAATTTTTGCCCAGAG

LOC540095-IN1.9R

GGTGTTCTTACCCTGTCTCAGC

LCORL

81413_159

GF102115

1233196

196003686

S

38359337

LOC540095-IN1.6F

AGGATCAACCATTAGGATGTGC

LOC540095-IN1.6R

AACTGGGAAGAGAGCAAGTGAG

LCORL

81413_221

GF102115

1233196

196003684

W

38359399

LOC540095-IN1.6F

AGGATCAACCATTAGGATGTGC

LOC540095-IN1.6R

AACTGGGAAGAGAGCAAGTGAG

LCORL

81413_226

GF102115

1233196

196003687

W

38359404

LOC540095-IN1.6F

AGGATCAACCATTAGGATGTGC

LOC540095-IN1.6R

AACTGGGAAGAGAGCAAGTGAG

LCORL

81413_231

GF102115

1233196

196003689

M

38359409

LOC540095-IN1.6F

AGGATCAACCATTAGGATGTGC

LOC540095-IN1.6R

AACTGGGAAGAGAGCAAGTGAG

LCORL

81413_238

GF102115

1233196

196003690

W

38359416

LOC540095-IN1.6F

AGGATCAACCATTAGGATGTGC

LOC540095-IN1.6R

AACTGGGAAGAGAGCAAGTGAG

LCORL

81405_282

GF102099

1233180

196003685

M

38376731

LOC540095-IN1.2F

TCGGGTCCTCTTTTACTGTCAT

LOC540095-IN1.2R

CTTACCACGATCTCCTTTCCAC


1 SNP in bold were genotyped using the Sequenom MassArray System.

2 Marker name in USMARC database.

3 IUB Codes for SNP are K = G/T, M = A/C, R = A/G, S = C/G, W = A/T, Y = C/T.

4 Position based on NM_174098 Bos taurus leucine aminopeptidase 3 (LAP3) mRNA; NM_001102376 Bos taurus non-SMC condensin I complex, subunit G (NCAPG), mRNA; and NM_001192357 Bos taurus ligand dependent nuclear receptor corepressor-like (LCORL) mRNA.

5 Position based on the Btau 4.0 genome assembly.

Lindholm-Perry et al. BMC Genetics 2011 12:103   doi:10.1186/1471-2156-12-103

Open Data