Table 1

Oligonucleotide primer sequences used for comparison of HRM and sequencing sensitivity and specificity.

Amplicon

Forward sequence 5'>3'

Reverse sequence 5'>3'

Location

size


3

CGGGACGTGAAAGGTTAGAA

TTTTGGGGTGGAAAATTCTG

promoter

653

39

TGGCCATCTACAAGCAGTCA

ACACGCAAATTTCCTTCCAC

exon5-intron5

211

40

CATGAGCGCTGCTCAGATAG

CAGTTGCAAACCAGACCTCA

exon6

234

41

GTGGAAGGAAATTTGCGTGT

TTGCACATCTCATGGGGTTA

intron6

212

43

TGGCTCTGACTGTACCACCA

TCTACTCCCAACCACCCTTG

intron 7

371

44

CTGGAAGACTCCAGGTCAGG

AGCTGTTCCGTCCCAGTAGA

intron7

383

46

GCGCACAGAGGAAGAGAATC

TGAAAGCTGGTCTGGTCCTT

intron9

452

47

GCAGTGATGCCTCAAAGACA

GCAGGCTAGGCTAAGCTATGA

intron9

280

48

TGACTTTGCCTGATACAGATGC

TAGCTACTGGGGAGGCAGAG

intron9

596

49

GGCCTGCCTAGCCTACTTTT

GTAGCAGGCGCTTGTAGTCC

intron9

578

50B

GACTACAAGCGCCTGCTACC

TTTCATGCAACCATGCTGTT

intron9

614

51

CCCTACAGTTGGGCAAAGTC

CGACTGTGCCTCGTTTCTTT

intron9

491

52A

CCTGGGCGATAGAGTGAGAC

GGCTGGACTCAAACTCTTGG

intron9

134

52B

GTCGCATGCACATGTAGTCC

CTTGAGTTCCAAGGCCTCAT

intron9

635

53

ACTTCTCCCCCTCCTCTGTT

CCTGGGTTTGGATGTTCTGT

exon10-intron10

348

55

TATACTCAGCCCTGCCATGC

GGACTTCAGGTGGCTGTAGG

intron10

603

57

TTTGGGTCTTTGAACCCTTG

GTGGTTTCAAGGCCAGATGT

exon11 (3'UTR)

400

58

GGCCCACTTCACCGTACTAA

AAGCGAGACCCAGTCTCAAA

exon11 (3'UTR)

485

59

AAGGAAATCTCACCCCATCC

AAATGCAGATGTGCTTGCAG

exon11 (3'UTR)

456

60

TTGAGACTGGGTCTCGCTTT

CAGTCTCCAGCCTTTGTTCC

566

61

AAAACTTTGCTGCCACCTGT

ATCCTGCCACTTTCTGATGG

415

62

GCCTCTCACCAAGGATTACG

CCTGGACAGTAGCACCCACT

535


Garritano et al. BMC Genetics 2009 10:5   doi:10.1186/1471-2156-10-5

Open Data