Table 2

Forward (F) and reverse (R) primers used to amplify (A) and sequence (S) the two mtDNA fragments

Primer

Sequence 5'-3'

Map position*

F/R

A

S


283

tacactggtcttgtaaacc

15908–15926

F

x

x

LemurDLF1

aagcctagtccatacgcatataagc

16181–16205

F

x

x

LemurDLR2

ggtagattaagctacgatc

16303–16321

R

x

x

LemurDLR4

atctcYtatgtccttcaagcat

219–240

R

x

x

282

aaggctaggaccaaacct

651–668

R

x

ND4F

taggaggataYggRataatacg

11472–11493

F

x

x

ND4R

atagatattagggtattttctcg

12053–12075

R

x

x


* Relative to human mtDNA [GenBank: V00662]

Pastorini et al. BMC Evolutionary Biology 2009 9:32   doi:10.1186/1471-2148-9-32

Open Data