Table 4

Adapters and Primers used in C genome specific sequence preparation

sequence name

primer name

Sequence(5'-3')


CS-1

CS1-F

TTTCCCAATCAAGTTCCT

CS1-R

ACGGTGGTAATGGTAGCC

CS-2

CS2-F

AAACAGCAGCGGAAAGAG

CS2-R

GCAAATAGCCATAAGCC

CS-3

CS3-F

CAAACCCAAACCACCCAAGC

CS3-R

GAACCATACCATCGCCGTCA

CS-4

CS4-F

CTGGTGCCTGCTTTAGTC

CS4-R

CCATACCGTTGCCTCTTA

CS-5

CS5-F

ACGACCAAGCCGACCAAC

CS5-R

TGCCTCTTCCACCACTAACT

CS-6

CS6-F

GCTTTGGGTTGGACTTGAC

CS6-R

TGAACTCGGTGAGATTGGA

CS-7

CS7-F

GGCTGACTGAAGGGAGGAGG

CS7-R

TGAGGTTGGACGCTGGACTG

CS-8

CS8-F

ATCATTCATTGCTCCATTC

CS8-R

AACAGCGTCCTCACCAG

adapter-C

C-adp1

GACCTCGTGTCTGCGTACC

C-adp2

TAGGTACGCAGACACGAG

adapter-B

B-adp1*

GACGATGAGTCCTGAG

B-adp2

TACTCAGGACTCAT


* 5' end biotinylated

Wang et al. BMC Evolutionary Biology 2009 9:250   doi:10.1186/1471-2148-9-250

Open Data