Table 2

Primers used for SDBE and Os125 gene amplifying and sequencing

Gene name

Primer

Sequence(5'-3')


Starch Debranching Enzyme

SDBE-F

ATTGTCTGCTGCTGGCTTGA

SDBE-R

CTATTGCCGCTTGTTGCTC

SDBE-Fs2

AAAGGGCAAGCCAACGCAAAT

SDBE-Fs3

TGGACAGCCGACAGACTTGC

Os02 g0125000

Os125-F

CCAGAAGAATGGGACAGC

Os125-R

GACAGGGAGTTCCAGAGC


Wang et al. BMC Evolutionary Biology 2009 9:250   doi:10.1186/1471-2148-9-250

Open Data