Table 1

Primers used for PCR amplification and DNA sequencing.

Oligomer

Sequence

Oligomer

Sequence


PDIA01F

AACCTCAACAGCAAAATCAACCA

PDIA12R

CACTTTGCGAGCTGTCCTTTGA

PDIA02R

GAGGGCTGGACCATCTGAGGT

PDIA13F

TGCGGATTCACCCATTC

PDIA03F

TGGGCACATCGGACTGCTTAC

PDIA14R

CCAAAGACAACCCGATAAGGAG

PDIA04R

GACATGCCTTTCCAAAGACAACC

PDIA15F

TTCCTATCTCCTTCTTTGCTTT

PDIA05F

GGCCCAAGCAGACCATACA

PDIA16F

TTGCCCCATTGATTGCTTG

PDIA06R

TAAAAATCAACAGGGAAAATCAGT

PDIA17R

TTTCAAATCACAAAATGTCAAG

PDIA07F

TGTCTCCGCATTGATTGGTAAA

PDIA18R

TGTAAGTCAGATGGATTGCCA

PDIA08R

ATTGGCTGTCGGAGATAGGATAAA

PDIA19R

GCTCCAAGGTCCATCACGA

PDIA09F

AAACCAGTAAGACAGCCACAGAGA

PDIA20R

GGACATCCTCATCAGGGTATTG

PDIA10R

CAAGGACAGCCCCCAATG

PDIA21F

CATGGGTGCTTTGAGGGTAA

PDIA11F

GAGGTGCGATCTTTTCTTGGTC


Yano et al. BMC Evolutionary Biology 2005 5:30   doi:10.1186/1471-2148-5-30

Open Data