Table 2

Details of primer pairs (restriction sites for XbaI and BamHI, and fluorescent CAG and M13R binding sites underlined) used for the cloning of pike Elovl5 ORF in pYES2, qPCR analysis of tissue expression and for the genotyping of Atlantic salmon paralogous genes
Species Aim Transcript Primer Primer sequence Amplicon size Ta Accession no.
E. lucius elovl5 cDNA cloning Elovl5 UNIE5OUTF 5’- ATGGATGGGTCCCAGAGA -3’ 437 bp 55°C JX272634a
UNIE5OUTR 5’- AGTTCATAACGAACCACCAGAT -3’
UNIE5INNF 5’- TGGGGCCCAAGTACATGA -3’ 388 bp 55°C
UNIE5INNR 5’- TGGACGAAGCTGTTAAGGG -3’
5’ RACE Elovl5 PIKE5_5’F 5’- GATGGCAGAGAGCCCATAGT -3’ 639 bp 55°C JX272634a
PIKE5_5’R 5’- CCACACAGCAGACACCATCT -3’ 336 bp 55°C
3’ RACE Elovl5 PIKE5_3’F 5’- AGATGGTGTCTGCTGTGTGG -3’ 1118 bp 60°C JX272634a
PIKE5_3’R 5’- ATGCTCAACATCTGGTGGTTT -3’ 915 bp 60°C
ORF cloning Elovl5 PIKE5OUTF 5’- GCCCAGGTTCGCATCACCCAG -3’ 1337 bp 60°C JX272634a
PIKE5OUTR 5’- ATTCCGGGGGTCATTTGAGATAGACG -3’
PIKE5ORF_F 5’- CCCGAGCTC
    GGATCC
AAATGGAGACTTTTAATCAGAGACTTAACACC -3’
922 bp 60°C
PIKE5ORF_R 5’- GGG
    TCTAGA
CTCGAGCTTCAGTCCGCCCTCACTTTCCT -3’
qPCR 18S qPCRp18SF 5’- TTCGAATGTCTGCCCTATCAAC -3’ 128 bp 55°C Contig2237b
qPCRp18SR 5’- CCTTCCTTGGATGTGGTAGC -3’
Elovl5 qPCRpELO5F 5’- CCTTTGCACTGACCGTGATA -3’ 195 bp 56°C JX272634a
qPCRpELO5R 5’- GCGTGTCCTGGCAGTAGAA -3’
Ef1-a1 qPCRpEF1F 5’- AAGATCGACCATCGTTCTGG -3’ 209 bp 55°C GH265867a
qPCRpEF1R 5’- CTGGCAGCCTTCTTATCGAC -3’
S. salar Genotyping Elovl5a MS_elovl5a_F 5’- ACAATTGCCATTTTTGCAGATAGC -3’ 175-231 bpc 58°C AGKD01037727a
MS_elovl5a_M13R 5’-
    GGATAACAATTTCACACAGG
AGCCATTCTTGATCCGCTTAT -3’
Elovl5b MS_elovl5b_CAG 5’-
    CAGTCGGGCGTCATCA
AGCCCGATATGATATTACCGTATT -3’
172-181 bpc 56°C AGKD01030045a
MS_elovl5b_R 5’- GTAAAATGGTGACTTTGGGTTCAG -3’

a GenBank [http://www.ncbi.nlm.nih.gov/ webcite].

b University of Virginia, Centre for Medical Research [http://lucy.ceh.uvic.ca/contigs/cbr_contig_viewer.py webcite].

c Scored from 10 parental samples.

Carmona-Antoñanzas et al.

Carmona-Antoñanzas et al. BMC Evolutionary Biology 2013 13:85   doi:10.1186/1471-2148-13-85

Open Data