Table 1

Primers used for amplifying Mhc class I exon 3 in great tits
Primer Sequence (5′ - > 3′) PCR Reference
HN34 CCATGGGTCTCTGTGGGTA gDNA [39]
HN45 CCATGGAATTCCCACAGGAA gDNA [39]
T3F TCCACACCATACAGCGAGTT gDNA, cDNA present study
GBT3R TTTACGCTCCAGCTCTTTCC gDNA, cDNA present study
GTJSF CGGCTGTGACCTCCTGTCC gDNA present study
GTJSR ATTCYGGGCAGATGTGCTT gDNA present study
S2F CACACCTCACAGTGGCTTTA gDNA, cDNA present study
S2R CAGCTCTTTCTGCCCATATC gDNA, cDNA present study
L2F CAATGGCTTTATGGCTGTGAC gDNA, cDNA present study
L2R CCAGCTCTTTCCTCCCGTAT gDNA, cDNA present study
JSG2F AGTTTCCGGCTGTGACCTC gDNA present study
JSG2R GCCCGTATTCGACGTATTTC gDNA present study
JSG3F CATACAGTGGCTTTATGGCTGT gDNA present study
JSG3R CCCGTATCCGGTGTATTTCC gDNA present study
MHCV-F CCCAGGTCTCCACACCATAC gDNA present study
MHCV-R AGCTCTTTCCGCCCGTATT gDNA present study
MHCD-F TTMYGGCTGTGACCTCCTG gDNA, cDNA present study
MHCD-R TTGCGCTYCAGCTCTTTC gDNA, cDNA present study

The primers were developed in the order from top to bottom (with the exception of HN34-45). MHCD-F and MHCD-R are the final primers designed for 454 pyrosequencing. F indicates forward and R indicates reverse primers. gDNA indicates amplification of genomic DNA and cDNA indicates amplification of cDNA libraries with the specified primer.

Sepil et al.

Sepil et al. BMC Evolutionary Biology 2012 12:68   doi:10.1186/1471-2148-12-68

Open Data