Table 1

Probe and primer sequences
Name Sequence
Type II AFP probe GCATCCATACACAGCCTTGAAGAGTATGCGTTTG TTAAGG
Type II AFP R CGCACCAGTCAGTAAAATCC
AFP (80) qF2 CCATACACAGCCTTGAAGAG
AFP (80) qR2 AATCTGAGCCTCCAATCC
PBAC-GMR primer F2 CTATAACCAGACCGTTCAGC
PBAC-GMR primer R2 CTATCCCATATCACCAGCTC
Smelt-LDH-A qF2 AACTCCAAGGTGGTGGTG
Smelt-LDH-A qR2 GGGACTGTACTTGACGATGT
Smelt-LUC7La qF1 AGGAGATCGGGAAGCTACT
Smelt-LUC7La qR1 CTGCGAACTTTCTCCACTT
O0139C19 SP6 F GTGTATCTTTGCCAGCCTAC
O0139C19 SP6 R AACGTCAACATGGAGGAGTA
O0139C19 T7 F CACGTCTGGATAGGTGAGAT
O0139C19 T7 R GAGAGATTGACCTGCACTGT
RBP-3-2 5′ inner GAYGTNTTYGARAAYAAYATHGG
RBP-3-2 3′ inner ACYTTRTTCCANACRTGYTCNAC
RBP-3-2 5′ outer ATHGCNGARGAYGTNGCNTAYTG
RBP-3-2 3′ outer TCRAARAARTANGARCARAANCC
RBP-3-2 5′ herring TCGGAGACTTTGAGCAGGTG
RBP-3-2 3′ herring TCACCTGCTCAAAGTCTCCG

Graham et al.

Graham et al. BMC Evolutionary Biology 2012 12:190   doi:10.1186/1471-2148-12-190

Open Data