Table 6

PCR Primers
Gene Primer name Sequence (5′-3′)
mmr-a4 MRPs3 ATGAAATCAATTTTATGTTCCTSCTG
MRPurt3 TTAATCARAATAAAGAGGAAAAG
mmr-a7 MRPs3.1 ATGAAATCAATTTTATGTATCCTSCTG
MRPutr1 GTATTTTTTATTTTTGATAAAAATCTG
mmr-b 2MRPs2 GTACCAGTYAAGCAAATAGCTGAACC
2MRPutr1 ATATTTTAAATTAACCTGAACC
hsp-82 Hsp3:b GARACNTTYGCNTTYCARGCN
hsp8:b RTGRTCYCCCARTCRTTNGT
coxI HCO2198 TAAACTTCAGGGTGACCAAAAATCA
LCO1490 GGTCAACAAATCATAAAGATATTGG

Gribble and Mark Welch

Gribble and Mark Welch BMC Evolutionary Biology 2012 12:134   doi:10.1186/1471-2148-12-134

Open Data